Hello, can someone help me answer these questions? Thank you! a) Describe the ty

Question

Hello, can someone help me answer these questions? Thank you!

a) Describe the types of chemical bonds in the DNA double helix.

b) Consider the following segment of DNA, which is part of a much longer molecule constituing a chromosome:

5' - ATTCGTACGATCGACTGACTGACAGTC - 3'

3' - TAAGCATGCTAGCTGACTGACTGTCAG - 5'

If the DNA polymerase starts replicating this segment from the right (continuing on toward the right, beyond what is shown) which will be the template for the LEADING strand? Circle correct strand)

Explanation / Answer

a) There is two types of chemical bonds in DNA double helix-

1.H- binding betwweb the nitrogenous bases of two strands of double helix DNA that hold them together.

2.Covalent bond which tightly hold base , sugar and phosphate of a nucleotide as well as nucleotides of of a single strands.

b) It is lower strand which acts as leading strand as shown in picture .

Related Questions

Navigate

• Browse (All)
• Browse H
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.