Q4. Use the strand of DNA shown here and the codon chart in your book, to answer
ID: 217864 • Letter: Q
Question
Q4. Use the strand of DNA shown here and the codon chart in your book, to answer the next questions Original template strand of DNA: 3' TAC GCA AGC AAT ACC GAC GAA 5" a. If this DNA strand produces an mRNA, what does the sequence of the mRNA read from 5' to $"2 b. For what sequence of amino acids does this mRNA code? (Assume it does not contain introns. c. Below are two mutations that may occur in the original strand of DNA. What happens to the amino acid sequence or protein produced as a result of each mutation? (Note: Position 1 refers to the first base at the 3' end of the above template strand. The last base in the DNA strand, at the 5' end, is at position 21) Mutation i: G at position 8 is changed to T Mutation ii: Addition of T between positions 8 and 9 Effect on amino acid sequenceExplanation / Answer
A) mRNA sequence - 5 AUGCGUUCGUUAUGGCUGCUU 3
B) Amino acid sequence - M-R-S-L-W-L-L
C) Mutation1) Serine at position 3 is replaced by stop codon sp no further amino acids beyond this point.
C) Mutation 2)There wull be a frame shift and resultant amino acid would be M-R--S-V-M-A-A
Feel free to leave a comment down below for any further questions. Thank you.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.