5) (2 pts) You wish to insert a piece of DNA which codes for a protein you wish

Question

5) (2 pts) You wish to insert a piece of DNA which codes for a protein you wish to express in E. coli in a plasmid which contains Hindill and BamHI insert sites to allow directional cloning. You may insert your DNA into this plasmid via a Sall which is found between the Hindill and BamHl sites. Which DNA sequence below represents this insertion site of the plasmid. (a) 5'-CCAAGCTTAACCGGTGCGAGCTGTTCCGGGGATCCAA-3' (b) 5'-CCAAGCTTAACCGAGCTCCTTCCGGGGATCCAA-3' (c) 5'-CCAAGCTTAACCGGTCGACTTCCGGGGATCCAA-3' (d) 5'-CCAAGCTTAACCGGTGCGACTTCCGGG GATCCAA-3'

Explanation / Answer

For this question you have to knowledge about the restriction site and their palindrome nature. Generally restriction enzymes are tetra, hexa and octa cutters. Tetra cutters generally form give the blunt end cuttings therefore they cannot be used for the directional cloning.

Hexa cutters are generally give the both blunt end and staggered end ( as shown below). Staggered end generally given the overhang. Only compatible sequence will bind and join at the same site. Hence DNA and vector both should be digesting with the same enzyme.

Octa cutter is rare enzymes and palindrome should be present.

For finding the answer in this question you can use the two approach.

You should know the sequence of the restriction site. But it is very difficult to memorize it. So use the second approach that finding of the palindrome sequence

If you read the sequence from 5’ ends of the both strand then they should be the same. See the example

5’GGATCC 3’

3’ CCTAGG5’

Read the sequence from 5’ end and underlined sequence. They are the same.

So as the question suggest that given answers must contain three palindromsequences. Write the compliment sequence and check the palindrome sequence.

Here option three is correct that contain three palindrome sequence

CCAAGCTTAACCGGTCGACTTCCGGGGATCCAA

Below I mentioned the sequence of three restriction enzymes.

Bam Hi restricition site is

5’GGATCC 3’

3’ CCTAGG5’

After digestion

5’G               GATCC 3’

3’ CCTAG               G5’

HindIII

5’AAGCTT3’

3’TTCGAA5’

After digestion

5’A          AGCTT3’

3’TTCGA           A5’

Sal I restriction site

5’GTCGAC3’

3’CAGCTG5’

5’G        TCGAC3’

3’CAGCT        G5’

Related Questions

Navigate

• Browse (All)
• Browse 5
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.