Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

The DNA sequence below represents an open reading frame (ORF) of an MHC transcri

ID: 262486 • Letter: T

Question

The DNA sequence below represents an open reading frame (ORF) of an MHC transcriptional unit. Transcribe and then translate this gene. 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?! The DNA sequence below represents an open reading frame (ORF) of an MHC transcriptional unit. Transcribe and then translate this gene. 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?! 5’ ATGAAAGCTCGTTGTATCTGA 3’ 3’ TACTTTCGAGCAACATAGACT 5’
Transcribed mRNA sequence?! Translated protein sequence?!

Explanation / Answer

Answer:

Coding strand---5’ ATGAAAGCTCGTTGTATCTGA 3’

Template strand---3’ TACTTTCGAGCAACATAGACT 5’

Template strand synthesizes mRNA.

mRNA - 5’ AUG - AAA - GCU - CGU - UGU - AUC - UGA 3’

Protein - Met - Lys - Ala - Arg - Cyc - Ile - STOP

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote