Consider the RNA sequence shown below: Note: The it\'s below the line are there

Question

Consider the RNA sequence shown below: Note: The it's below the line are there just to help you unt the bases they have no other significance 5' GCCGAGUGCCACAAUGGUCUAAGGAGGUAUGAGUAUGUUGAAUUCUAGUUAGUCUAACGCACCUUUCAAAAAAAA3 #10 #20 #30 #40 #50 Figure 1 Question 13: What would be the peptide produced from this RNA in E.coli? Question 14: If a methyl G cap were added to this RNA at its 5' end and the resulting mRNA (Figure 2 shown below) were introduced into an eukaryote - what would be the resulting peptide (if any) produced from this RNA? CHa 5 GCCGAGUGCCACAAUGGUCUAAGGAGGUAUGAGUAUGUUGAAUUCUAGUUAGUCUAACGCACCUUUCAAAAAAAA3 10 #20 130 440 450 Figure 2 Question 15: If nucleotide # 6 (G) were deleted in this RNA (Figure 2)-what would be the resulting peptide (if any) produced from this RNA in a eukaryote? Question 16: If the modified RNA with the methyl G cap and the deleted G (Figure 2 & above question) were re-introduced back into E. coli - what would be the resulting peptide (if any)? 73

Explanation / Answer

Consider the RNA sequence shown below: Note: The it's below the line are there

Related Questions

Navigate

• Browse (All)
• Browse C
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.