This is the sequence of the first exon of a mouse gene. CGGGCACCATGAGC CGTGGCTAT
ID: 268735 • Letter: T
Question
This is the sequence of the first exon of a mouse gene. CGGGCACCATGAGC CGTGGCTATTGTG... a) What would be the consequence of deleting the boxed nucleotides? b) What would be the expected impact of this deletion on the protein function? c) What would be the expected impact for the mutant mice? 2. The following sequence is located at the beginning of a gene. The underlined part corresponds to an intron, which flanks two exons. ATTAGCCATGCTCTCCGTCCCAACTGTAAGTATGCGCGAGATCGTTACCAGGATGATTGT... What would be the expected impact of the following : a) ATTAGCCATGCT TCCGTCCCAACTGTAAGTATGCGCGAGATCGTTACCAGGATGAT... C to G b) ATTAGCCATGCTCTCCGTCCCAACTGTAAGTATG CGAGATCGTTACCAGGATGAT... CG to AA c) ATT GCCATGCTCTCCGTCCCAACTGTAAGTATGCGCGAGATCGTTACCAGGATGAT... A to G 3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are written using uppercase letters. 3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are written using uppercase letters.CHAPTER 2 GENE VARIANTS &POLYMORPHISMs; Problems 1?This is the sequence of the first exon of a mouse gene. ATGAGCGACGTGGCTATTGTG.. a) What would be the consequence of deleting the boxed nacleotides? b) What would be the expected impact of this deletion on the protein function? c) What would be the expected impact for the mutant mice? 2. The following sequence is located at the beginning of a gene. The underlined part corresponds to an intron, which flanks two exons What would be the expected impact of the following mutations TGAT C to G TGAT CG to AA ATGAT... e) ATTGGCCA A to G 3. A research team sequenced a human gene and the corresponding mRNA. Here is the sequence of the genomic DNA. The parts that are identical between the genomic DNA and the mRNA are using uppercase letters written agcgaaatttaatgagcgtgtaacageggactgaaaatcctgatttetcaAGCTATCAAA GGTTTATAAAGCCAATA del 1 TCTTCTCTGGT GAACATAAACATCAAAGGATCGCCAT del 2 agtgtgacaactcactgegttggtggetegegttettatgagetaag Del 3 CCACTACATCCATAACCTCTCCTCAGAAATGTTCAGCGAATTCgtaagtaccatgcttet
Explanation / Answer
1.
a. There will be no consequences of deleting the nucleotide as the codon initially was GCG and now after mutation is GCC. Both code for the same amino acid.
b. Protein function will not be changed as the Codon changed for amino acid will not be changed. It will remain the same.
c. There will no effect on the mutant mice as protein sequence is remain same.
2. a.
The mutation result in the change of protein sequence as the mutation is taking place in exon.
b. There will no effect of this mutation as this takes place in intron that is non coding part.
c. Protein sequence will changed as the mutation is occurring in exon.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.