THINKING LAB Identifying Mutations and Predicting Their Consequences Background
ID: 279532 • Letter: T
Question
THINKING LAB Identifying Mutations and Predicting Their Consequences Background As you have seen, a change in a single nucleotide makes the difference between a normal hemoglobin protein and the altered protein associated with sickle cell disease. This table shows nucleotide sequences from different forms of an imaginary gene. In this lab, you will examine these sequences to identify different types of mutations and predict their consequences. Gene typeNucleotide sequence (trom template DNA strand) wild (normal) Mutant 1 Mutant 2 Mutant 3 TACCTCTTTCGGGTAACAATAACT TACCTCTTTCGGGTAACTAATAACT TACCTCTTCGGGTGACAATAACT TACCTCTTTCGGGTAAAAATAACTExplanation / Answer
3. To know the function of the gene, if it codes for a protein, for example probably the risk to be harmful would be more. Also, to know the place in the 3D structure of the product (for example in an enzyme, where it would take place, as it would not be the same that the mutation ocurrs in the active site of the enzyme compare to another structural site in the enzyme). Finally, it would be important to know the kind of mutation, for example if it is a deletion, an inversion, etc, this kind of mutation would affect the effect because it would dictate how the 3D structure and function would be.
4. Wild type= TACCTCTTTCGGGTAACAATAACT
Point mutation= TAACTCTTTCGGGTAACAATAACT (a point mutation is when a single nucleotide base is changed, inserted or deleted from the sequence, in this case on nucleotide was changed, it changed from a C to a A.)
Here we can´t make the exact excercise, as it is a group work, but we can assume that two mutations in the same gene can have a cumulative effect that probably really affects the organism metabolism, as the product of that gene is going to be really different as it should normally be. Also, there is a likelihood in reverse mutations in all living organisms but its probability is not high.
Related Questions
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.