Certain genes of human papilloma virus are encoded by partially overlapping read
ID: 314985 • Letter: C
Question
Certain genes of human papilloma virus are encoded by partially overlapping reading frames. The following sequence encodes both the 3’ end of the E1 coding region and a portion of the 5’ end of the E2 gene. (Both genes are encoded on the same strand).
The symbol § indicates the first base of a codon in the E1 reading frame, while ¶ indicates the start of a codon in the E2 reading frame. Translate the sequence in both reading frames. Use a genetic code chart from your book or other reliable source.
TCAGCTAATGAACATTTATGA
§¶
Explanation / Answer
Answer:
First reading frame, E1:
DNA sequence: TCAGCTAATGAAVATTTATGA (The start codon has been underlined)
Translated sequence: S A N E H L Stop
Second reading frame, E1: TCAGCTAATGAACATTTATGA (The start codon has been underlined)
Translated sequence: Q L Met N I Y
The encoded protein in the E2 reading frame starts with Met.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.