Glyceraldehyde 3-phosphate dehydrogenase abbreviated to GAPDH is used as a contr

Question

Glyceraldehyde 3-phosphate dehydrogenase abbreviated to GAPDH is used as a control for gene expression as it is considered a housekeeping gene. We will use siRNA to knock down the expression of GAPDH in a Human cell line (HEK293 cells). We will then measure expression of this gene before and after siRNA treatment using Quantitative RT-PCR.

Describe each of the following terms: cDNA, siRNA, RT-PCR and Q-PCR (3 pts each)

What is a housekeeping gene and why are they used as a control for gene expression? (3 pts)

Design primers to be used for Q-PCR to amplify the human GAPDH gene. Include in your answer:

a. the GAPDH sequence (Genbank accession number)

b. the amplicon size (you will need to determine the optimal amplicon size for Q- PCR)

c. the PCR primer sequences and a diagram showing the location of your primer sequences relative to the gene structure of human GAPDH (hint: Remember you are working with a eukaryotic gene what do you need to consider regarding gene structure) (10 pts)

Explanation / Answer

Describe:

1. cDNA: Complementary DNA (cDNA) is DNA synthesized from a mature mRNA template in a reaction catalyzed by the enzyme reverse transcriptase and the enzyme DNA polymerase. cDNA is often used to clone eukaryotic genes in prokaryotes. When scientists want to express a specific protein in a cell that does not normally express that protein (i.e., heterologous expression), they will transfer the cDNA that codes for the protein to the recipient cell.

The term cDNA is also used, typically in a bioinformatics context, to refer to an mRNA transcript's sequence, expressed as DNA bases (GCAT) rather than RNA bases (GCAU).

cDNA is derived from eukaryotic mRNA, so it contains only exons (Coding region), with no introns (Non Coding region).

2. siRNA: siRNA is a synthetic RNA duplex designed to specifically target a particular mRNA for degradation. While siRNA provides the opportunity to induce gene knockdown in a variety of cell lines, their utility is limited to cells that are amenable to transfection of synthetic oligonucleotides. Small (or short) interfering RNA (siRNA) is the most commonly used RNA interference (RNAi) tool for inducing short-term silencing of protein coding genes.

Working of siRNAs: siRNAsconsist of two RNA strands, an antisense (or guide) strand and a sense (or passenger) strand, which form a duplex 19 to 25 bp in length with 3' dinucleotide overhangs. Synthetic siRNAs are most commonly generated through solid-phase chemical synthesis methods (such as patented 2'-ACE chemistry) which provide highly pure, stable, and readily modified siRNAs. Small double-strand siRNAs are transfected into cells where the guide strand is loaded into RISC. This activated protein and nucleic acid complex can then elicit gene silencing by binding, through perfect complementarity, to a single target mRNA sequence, thereby targeting it for cleavage and degradation.

3. RT-PCR: Reverse transcription polymerase chain reaction (RT-PCR), a variant of polymerase chain reaction (PCR), is a technique commonly used in molecular biology to detect RNA expression.

In RT-PCR, the RNA template is first converted into a complementary DNA (cDNA) using a reverse transcriptase. The cDNA is then used as a template for exponential amplification using PCR. The use of RT-PCR for the detection of RNA transcript has revolutionalized the study of gene expression in the following important ways:

Made it theoretically possible to detect the transcripts of practically any gene.Enabled sample amplification and eliminated the need for abundant starting material required when using northern blot analysis.Provided tolerance for RNA degradation as long as the RNA spanning the primer is intact.

4. Q PCR:

A real-time polymerase chain reaction (Real-Time PCR), also known as quantitative polymerase chain reaction (qPCR), is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR, i.e. in real-time, and not at its end, as in conventional PCR. Real-time PCR can be used quantitatively (quantitative real-time PCR), and semi-quantitatively, i.e. above/below a certain amount of DNA molecules (semi quantitative real-time PCR).

Two common methods for the detection of PCR products in real-time PCR are: (1) non-specific fluorescent dyes that intercalatewith any double-stranded DNA, and (2) sequence-specific DNA probes consisting of oligonucleotides that are labelled with a fluorescent reporter which permits detection only after hybridization of the probe with its complementary sequence.

5. What is a housekeeping gene and why are they used as a control for gene expression?

In molecular biology, housekeeping genes are typically constitutive genes that are required for the maintenance of basic cellular function, and are expressed in all cells of an organism under normal and patho-physiological conditions. Although some housekeeping genes are expressed at relatively constant rates in most non-pathological situations, the expression of other housekeeping genes may vary depending on experimental conditions.

Data normalisation in real-time RT-PCR is a further major step in gene quantification analysis (Bustin 2002, Pfaffl 2001 ). The reliability of any relative RT-PCR experiment can be improved by including an invariant endogenous control (reference gene) in the assay to correct for sample to sample variations in RT-PCR efficiency and errors in sample quantification. A biologically meaningful reporting of target mRNA copy numbers requires accurate and relevant normalisation to some standard and is strongly recommended in quantitative RT-PCR.

Normalisation of target gene expression levels must be performed to compensate intra- and inter-kinetic RT-PCR variations (sample-to-sample and run-to-run variations). Housekeeping genes are use for normalisation of target gene.

6a. ACCESSION number of GAPDH: NM_002046

6b.aMPLICON SIZE: 81bp (can vary from 80 to 120 bp)

6c: forward primer: 5'CTGGTAAAGTGGATATTGTTGCCAT3'

Reverse primer: 5'TGGAATCATATTGGAACATGTAAACC3'

Related Questions

Navigate

• Browse (All)
• Browse G
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.