An organism is discovered whose RNA polymerase II has the following properties:

Question

An organism is discovered whose RNA polymerase II has the following properties:

The DNA sequence in the template strand 3'-TATAATA-5' serves as the promoter.

Transcription begins at the nucleotide immediately following the promoter.

Transcription continues until the transcript includes the sequence 5'-GGGGG-3', at which point the polymeraseswitches to the other DNA strand and continues transcribing (still adding nucleotides only to the 3' end of the growing chain).

Transcription terminates immediately after transcribing 5'-TATATA-3' from the template strand.

If the primary transcript is used as the mRNA, what mRNA sequence (before capping) would be produced from the DNA sequence shown above?

Explanation / Answer

Hahaha Nice question :-

original sequence:-

5'-CCGTATATATTATGATCAATATGCATGCTCTCGGGGGTCACACT-3'
3'-GGCATATATAATACTAGTTATACGTACGAGAGCCCCCAGTGTGA-5'

The template strand is in bold and the promoter and flipping portion are underlined

The RNA Pol can only go from 5' to 3' , hence the template must be from 3' to 5'. So let's start:-

The mRNA (which will loo like the top strand except T to U (Uracil) transitions ):-

5' - GAUCAAUAUGCAUGCUCUCGGGGGCCCCCGAGAGCAUGCAUAUUGAUCAUAAUAUAUA -3'

see, the flip in the strands means the pol will now go in reverse, transcribing using the other (top in original) strand as a template, but, it will keep on adding only 5'-3' , so the bold part is actually the sequence of the bottom strand in the original DNA , only it is reversed.

Read through the whole thing again if it appears wierd, and comment if in doubt

CHEERS Please rate if you like it :)

Related Questions

Navigate

• Browse (All)
• Browse A
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.