Tazswana Williams was born a healthy baby girl on August 4. 2005. Labor and deli

Question

Tazswana Williams was born a healthy baby girl on August 4. 2005. Labor and delivery proceeded without complication. On her first birthday, Tazswana was a vivacious yet petite toddler who loved to run and play. However, at 13 months of age, Tazswana had stopped running around. Coincidently, she began to look pale and lost her appetite. Concerned, her mother took Tazswana to the family pediatrician.

After a routine exam, Dr. Vivian Kernodle reassured Mrs. Williams. “According to the growth chart, her weight and length are both in the 25th percentile, which is still just within the normal range. Additionally, you and Mr. Williams are petite, so Tazswana comes by it naturally. She is exhibiting symptoms that are consistent with a recent flu virus that’s been going around. No need to be concerned at this point. If her appetite and color don’t return by late next week, give us a call.”

After a week, Tazswana’s symptoms had not subsided. Mrs. Williams called the doctor’s office Friday and made another appointment for the following Monday. During Tazswana’s second examination, Dr. Kernodle expressed concern. “Mrs. Williams, Tazswana’s spleen seems slightly enlarged. This typically indicates that it is working extra hard to produce immune cells to fight offinfections. However, it could be an indication of other conditions involving the blood stream. I would like to go ahead and draw some of Tazswana’s blood and yours to run a few tests."

Because of the family's sub-Saharan ancestry, Dr. Kernodle suspects that Tazswana may have an inherited blood disorder known as Thalassemia which occurs because of a mutated beta-hemoglobin protein. One of the causes of Thalessemia is a mutation in a sequence of DNA that codes for an intron in the pre-mRNA that codes for beta-hemoglobin.

1.These are two sequences of nucleic acids that code for a portion of Beta-hemoglobin. What type of nucleic acid are these? (The single site mutation is bolded)

Normal: AUGCAGGUAGUCAGAAGAAGUUUCCAGCACUAG

Mutated: AUGCAGGUAGUCAGAAGAAGGUUCCAGCACUAG

a) DNA

b)RNA

c) There is no way to know

2. In the mutated DNA, a _____ has been changed to a _____.

For the next two questions use the following two sequences

Normal:

AUGCAGGUAGUCAGAAGAAGUUUCCAGCACUAG

Mutated:

AUGCAGGUAGUCAGAAGAAGGUUCCAGCACUAG

Assume that the splicosome recognizes "GU" as the beginning of an intron and "CAG" as the end of the intron. For your convenience I have highlighted the corresponding sequences of bases in the normal and

(The color order is: green, pink, blue, purple, white)

3. In the normal DNA, what color(s) represent exons? (select all that apply)

a) green

b) pink

c) blue

d) purple

e) white

4. The single site mutation is bolded and underlined. In the normal protein, does this nucleotide get translated into a protein? Yes or no?

Explanation / Answer

1. These are two sequences of nucleic acids that code for a portion of Beta-hemoglobin. Both of them are RNA. One

2. In the mutated DNA, a G has been changed to a T

3. There may be single site mutation at C to G at position of 16 of IVS2 or G to T at the position of 74 of IVS2.

4. This base substituion changes the invarient acceptor dinucleated AG to GG.

5. B-thalasemia is due to RNA processing errors, which under goes alternative splice, leading to synthesis of abnormal B-globin mRNA.

6.The single site mutation in mRNA are processed to remove the mutated gene. So that nucleotide do not tranlsate into protein, it produce defective hemoglobin.

Related Questions

Navigate

• Browse (All)
• Browse T
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.