When doing this shared derived character matrix, would they all have 40 on the s

Question

When doing this shared derived character matrix, would they all have 40 on the shared because they all have 40 base pairs? Or how would you do that? On the derived, what do you do? Thanks 40 DNA sequences: 30 E: GTAATGCTACTGCAGGTATATCGTATGTCTAGCTGCCATG H: GTAATGCTACTCGAGGTATATCGTATGTCTAGCTGCCATG B: GAAATGCTACTCGAGGTATATCGTATGTCTAGCTGCCATG G: GAAATGCTACTCGAGGTATATCGTATGTCTAGCTCCCATG C: GTAATGCTACTGCAGGCATATCGTATGTCTAGCTGCCATG S: GTAATGCTACTGCACGCATATCGTTTGTCTAGCTGCCATA 20 10 EL- Shared derived character matrix raw a tree with this information. Map character changes on t ee as in the text figures (a line through the interior branch dicating which nucleotide position changed there; i.e.: -2) so map at least 4 phenotypic traits on the tree (including he e: # of chambers) that you observe in these organisms.

Explanation / Answer

Even if they all have 40 pairs , the sequence differs and hence the shared cound decreases.

See in the case of E and H

E : GTAATGCTACTGCAGGTATATCGTATGTCTAGCTGCCATG

H : GTAATGCTACTCGAGGTATACGTATGTCTAGCTGCCATG

Here E and H differes as highlighted above in 2 character and hence the shared count is 40 - 2 = 38.

Similarly you can find out others as well.

Related Questions

Navigate

• Browse (All)
• Browse W
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.