Here is a single-strand of DNA: 3’ – ACCTAGGACAAAGGTTTCACGCG – 5’ either above o

Question

Here is a single-strand of DNA:

3’ – ACCTAGGACAAAGGTTTCACGCG – 5’

either above or below this strand, write the complementary strand of DNA. Include which end is the 5’ end and which is the 3’ end.

if the original strand is the template for the leading strand, draw an arrow indicating which direction DNA synthesis will proceed

If the original strand is the template strand of a gene being transcribed, draw and arrow indicating which direction RNA synthesis will proceed

Write the sequence of the RNA molecule that would be transcribed from the original strand of DNA. Label the 5’ and 3’ ends

Explanation / Answer

3' - ACCTAGGACAAAGGTTTCACGCG - 5' -------------- Original strand of DNA Given

5' -TGGATCCTGTTTCCAAAGTGCGC - 3' ---------------- Complementary strand of DNA.

------------> DNA synthesis will occur from 5' to 3' Direction. Hence this is the direction in which DNA synthesis will proceed. mRNA synthesis also occurs in the same direction - 5' to 3'.

5' - UGGAUCCUGUUUCCAAAGUGCGC - 3' ------------ This will be the transcribed RNA. In RNA the bases will be the same as the non coding strand except that "T" replaced by "U"

Related Questions

Navigate

• Browse (All)
• Browse H
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.