Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Can someone just answer multipl choice question 92 to 94 CGACTGACTCGACGGCCTAGCTA

ID: 71510 • Letter: C

Question

Can someone just answer multipl choice question 92 to 94

CGACTGACTCGACGGCCTAGCTATAG. the primer is GCTGACTG. The number of DNA frargment resulting from the ddCTP tube is expected to be: for the sequencing result shown below, choose the correct sequence of template DNA 5' to 3'.Hybridization was used to determine the genotypes of 3 female family members with regard to hemophilia. The result are shown below. Each pair of dots represents the result from one person. The upper row represent hybridization using the probe deesigned to the mutant sequence and the lower row represents the results

Explanation / Answer

92. Option C is correct

93. Option D is correct (upper row individual 1 is hybridized with mutated probe for one allele but not hybridized with wild-type probe in the 2nd row individual 1 of 2nd allele i.e. that is also a mutated allele could not be hybridized with wild-type probe)

94. Option B seems to be not true

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote