Assume that the sequence below has experienced a spontaneous mutation resulting
ID: 7787 • Letter: A
Question
Assume that the sequence below has experienced a spontaneousmutation resulting in the tautomeric forms of all of the bases. Further assume that this shifted sequence serves as a template in replication. Write the new sequence of the complementary strand as a result of this shift and identify the type of substitution (if any) for each base on new complementary strand compared to the original complementary strand.
Sequence (5’ TO 3’)
CGGTGTGACACTAGGTAGTCTAACGAGCTCACGGGCAGGGCTATATGTTGCAAAGTCGTAGGTCAC
Complementary sequence (3’ TO 5’)
GCCACACTGTGATCCATCAGATTGCTCGAGTGCCCGTCCGATATACAACGTTTCAGCATCCAGTG
Explanation / Answer
The original template strand is: CGG TGT GAC ACT AGG TAG TCT AAC GAG CTC ACG GGC AGG GCT ATA TGT TGC AAA GTC GTA GGT CAC The mutated template is: TAA CAC AGT GTC GAA CGA CTC GGT AGA TCT GTA AAT GAA ATC GCG CAC CAT GGG ACT ACG AAC TGT Due to tautomerism, A binds with G and C binds with T. The mutated new complementary strand is: ATT GTG TCA CAG CTT GCT GAG CCA TCT AGA CAT TTA CTT TAG CGC GTG GTA CCC TGA TGC TTG ACA The type of substituition is transition as A is converted to G and C is converted to T.
Related Questions
Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.