In the following questions, you will show the process by which the TYR gene is u
ID: 80295 • Letter: I
Question
In the following questions, you will show the process by which the TYR gene is used to make the tyrosinase protein. The figure below shows a fragment of DNA from chromosome 11, which contains the TYR gene. Using the information that is given about the promotor, terminator and intron sequences below, State the purpose of basal transcription factors and RNA polymerase, and on the fragment of the DNA own below, indicate where these would bind Show what the pre-mRNA would look like. Be sure to indicate which is the 5' and which the 3' end. Under the pre-mRNA show what the mature mRNA would look like. Under the mature mRNA show the sequence of amino acids in that is coded for by this gene. Label the start and stop codons in the mRNA strand. Direction of transcription rightarrow 5' to 3' Strand of DNA: 5'TGTGCGGGCGCGGAGGAGGCA TGTTCTTGGTTTTAGCAACGCTGGAACTGCGTAGCGGCCATTGACGTAAACGATGACCACAG-3'. Promoter: 5'GCGGGCGCGGAG3' Terminator: 5' ACGATGACC3' Introns: mRNA 5'UUUUA3'Explanation / Answer
TGTGCGGGCGCGGAGGAGGCATGTTCTTGGTTTTAGCAACGCTGGAACTGCGTAGCGGCCATTGACGTAAACGATGACCACAG
(1) The transcription factor are protein that bind directly to the promoter regions of DNA lying upstream of the coding region in a gene or to an RNA polymerase. They can activate or block RNA polymerase.
The RNA polymerase is an enzyme useful in transcription, that is for converting a DNA to RNA in specific genes.
(2) pre-mRNA
5'-UGUGCGGGCGCGGAGGAGGCAUGUUCUUGGUUUUAGCAACGCUGGAACUGCGUAGCGGCCAUUGACGUAAACGAUGACCACAG-3'
(3) Mature mRNA
5'-AUGUUCUUGGUUUUAGCAACGCUGGAACUGCGUAGCGGCCAUUGACGUAA-3'
(4) Sequence of amino acids:
Met Phe Val Leu Ala Thr Leu Glu Leu Arg Ser Gly His
(5) AUGUUCUUGGUUUUAGCAACGCUGGAACUGCGUAGCGGCCAUUGACGUAA
(Bold): start codon (AUG)
(Bold/italics/underline): stop codon (UAA)
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.