Retinoblastoma is a cancer of the eye, and is linked to decreased RB1 protein ac

Question

Retinoblastoma is a cancer of the eye, and is linked to decreased RB1 protein activity. A German patient with retinoblastoma carries an RB1 allele with at G T mutation in the first nucleotide of the 6 intron of the gene Researchers designed primers to target exons 5 and 7 of RB1,and performed RT-PCR using mRNA extracted from a blood sample donated (1) by the retinoblastoma patient or (2) by a normal individual. They analyzed the RT-PCR reactions by agarose gel electrophoresis and ethidium bromide staining, as shown below (1) (2) Next, they isolated each of the amplified bands and carried out DNA sequencing The top band contained the normal sequence for exons 5-6-7, however the lower band lacked all of the exon 6 sequence Shown below is the DNA sequence from the end of exon 5 to the beginning of exon 7, with exon 6 underlined. Codon are alternately shaded, with the correlating amino acid shown underneath AGCAGTTCGATATCTACTGAAJATAAAATTC TGCATTGGTGCTAAAAAGT TTCTTGGATCUACATTTTT ATTAGCTAAAGGGGAAGTA

Explanation / Answer

Agarose gel electrophoresis is a technique used in molecular biology to seperate mixed populations of macromolecules such as DNA and proteins on an agarose gel. It is the easiest way to seperate and analyse DNA or RNA molecules. In this technique, DNA or RNA molecules are separated on the basis of charge by applying an electric field. Shorter molecules migrate more easily than larger through agarose medium. The DNA can be visualized in the gel by the addition of ethidium bromide.

Here, in this question the agarose gel electropheresis has two bands. The first band belongs to the patient of retinoblastoma and the second band to a normal individual. The first band is broken in the middle. DNA analysis showed top band contains all the normal sequences for exons 5-6-7 and the lower band lacked the sequence 6. Retinoblastoma is caused due to mutation in the 6th intron of the gene. So, this electrophoretic pattern on agarose gel confirms the presence of mutation in the 6th position of gene in retinoblastoma patient. Electrophoretic pattern of the normal individual acts as a control for intrepreting the results.

Related Questions

Navigate

• Browse (All)
• Browse R
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.