1.The transcription factor SP1 binds the sequence GGGCGG. Below is shown the seq

Question

1.The transcription factor SP1 binds the sequence GGGCGG. Below is shown the sequence of the SV40 early promoter with 6 of these GC boxes underlined. Starting with this DNA fragment and purified SP1, describe
how you would use DNAase I to map the SP1 binding sites on the SV40 early promoter. Draw a picture of a gel showing your results.
CCAT ATGCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCT CCGCCCGGG
GGTATACGGGCGGGGATTGAGGCGGGTAGGGCGGGGATTGAGGCGGGTCAAGGCGGGTAAGAGGCGGGCCC

2. You propose to correct a genetic defect in mice by introducing the DNA sequences encoding the missing protein into mouse embryos. To be useful, the protein must be expressed only in the liver. What DNA
sequences must be introduced along with the protein-coding segment to insure liver-specific expression of this protein?

Explanation / Answer

sequence with dna find your self

Related Questions

Navigate

• Browse (All)
• Browse 1
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.