Biology and Genetics
101624 questions • Page 367 / 2033
7. The enzyme mannose 6-P isomerase catalyzes the reversible reaction: Mannose 6
7. The enzyme mannose 6-P isomerase catalyzes the reversible reaction: Mannose 6 P (M6P) Fructose-6-P (FER ). The fructose-6-P (F6P) formed can then enter glycolysis. The K 3.1. A…
7. The equation for the oxidation of glucose is C,H,,06 (s) + 6 O2 (g) # 6 H2O (
7. The equation for the oxidation of glucose is C,H,,06 (s) + 6 O2 (g) # 6 H2O (l) + 6 CO2(g) The standard free energy of this combustion reaction, -2880 kJ/mol, is clearly very s…
7. The figure below shows a signal transduction pathway involving two proteins f
7. The figure below shows a signal transduction pathway involving two proteins found in the cytoplasm -JAK and STAT. Based on this figure, what are the roles of JAK and STAT in th…
7. The following double-stranded DNA contains sequence of a eukaryotic gene: 3\'
7. The following double-stranded DNA contains sequence of a eukaryotic gene: 3' TACCG GAATATTAGTCCTTT GTCGATACCGGTACTCGTGCG 5 5' CAGTCTCGGCATTATCCTATTAAAGGGAACTGAGGTGA-3 a) Transc…
7. The following is an article about a young man who died of plague in 2015. Bas
7. The following is an article about a young man who died of plague in 2015. Based on the information provided, you can correctly determine that this very unfortunate death was du…
7. The following is an article about a young man who died of plague in 2015. Bas
7. The following is an article about a young man who died of plague in 2015. Based on the information provided, you can correctly determine that this very unfortunate death was du…
7. The following names are all considered to represent the same taxon. The date
7. The following names are all considered to represent the same taxon. The date in parentheses following each name is the date of its effective publication Erythraea muhlenbergi G…
7. The following pedigree shows inheritance of the inability to smell Pseudomona
7. The following pedigree shows inheritance of the inability to smell Pseudomonas bacteria and the inability to roll the tongue into a U-shape Inability to roll the tongue is an a…
7. The following pedigree shows inheritance of the inability to smell Pseudomona
7. The following pedigree shows inheritance of the inability to smell Pseudomonas bacteria and the inability to roll the tongue into a U-shape Inability to roll the tongue is an a…
7. The graph shows a hypothetical pathway similar to glycolysis, in which the ca
7. The graph shows a hypothetical pathway similar to glycolysis, in which the catabolic intermediates are designated A, B, C, etc. The energetic contributions of activated carrier…
7. The hybrids between tetraploid and diploid plants of the same ancestral speci
7. The hybrids between tetraploid and diploid plants of the same ancestral species are usually sterile. A) B) C) D) E) are triploid. have chromosomes that usually synapse incorrec…
7. The largest size particle that a stream can carry is: a. 8 centimeters. b. mo
7. The largest size particle that a stream can carry is: a. 8 centimeters. b. moved in suspension. . stream discharge. d dependent on stream velocity. 8. As the velocity of flow d…
7. The latitude of the upper right (northeast) corner of the map is 35°30\' N, w
7. The latitude of the upper right (northeast) corner of the map is 35°30' N, while the longi- tude of the lower left (southwest) corner of the map is 11000' W. Why is this called…
7. The light-independent reactions were discovered by a. M. D, b. Andrew Benson.
7. The light-independent reactions were discovered by a. M. D, b. Andrew Benson. C. Melvin Calvin. d. Robert Hill e. both Andrew Benson and Melvin Calvin. Hatch 8. For each six at…
7. The location of a specific gene on a specific chromosome is callec A. genetic
7. The location of a specific gene on a specific chromosome is callec A. genetics B. genome C. locus . allele 58. Which of the following is NOT true about alleles? A. alleles are …
7. The major producto) in the product(s) in the following reaction is (are) CH,C
7. The major producto) in the product(s) in the following reaction is (are) CH,CH2 OCHy CH CHyCH2 CH, OCH, CH3CH2 [A] Only I B) Only II ICJ A racemie miture of U) and !] D] None o…
7. The map of a chromosome interval is: A10 mu40 muC low many double crossovers
7. The map of a chromosome interval is: A10 mu40 muC low many double crossovers would be expected out of 1000 progeny from the cross: Abe l aBC x abc I abc 8. In Drosophila, the g…
7. The nurse encourages the client to maintain a steady weight in the recommende
7. The nurse encourages the client to maintain a steady weight in the recommended range to decrease risk of the most common endocrine disease observed in the elderly, which is: a.…
7. The pedigree below is of a family with Huntington disease, a dominant conditi
7. The pedigree below is of a family with Huntington disease, a dominant condition that leads to dementia. The numbers indicate the number of tri-nucleotide repeats associated wit…
7. The pedigree below shows the inheritance of a rare human genetic disorder. A.
7. The pedigree below shows the inheritance of a rare human genetic disorder. A. Does a dominant or recessive allele produce the trait? Explain. 2 points) B. Is it an autosomal or…
7. The petals of the plant Collinsia parviflora are normally blue, giving the sp
7. The petals of the plant Collinsia parviflora are normally blue, giving the species its common name, blue-eyes Mary. Two pure breeding lines were obtained from color variants fo…
7. The pharmacist is asked to provide a cyclic rate for a home TPN. The dosage i
7. The pharmacist is asked to provide a cyclic rate for a home TPN. The dosage is (a volume to be given in) ml of (certain percent) dextrose over (given numbers) hours with a titr…
7. The potential for irredentism in Eastern Europe: Examine Figure 4-22 (\"Ethni
7. The potential for irredentism in Eastern Europe: Examine Figure 4-22 ("Ethnic Mosaic of Europe's Eastern Flank") to find the situations in Eastern Europe that have potential fo…
7. The reaction in which inorganic phosphate, Pi, is released from ATP is an exa
7. The reaction in which inorganic phosphate, Pi, is released from ATP is an example of? a. respiration b. photosynthesis c. oxidation d. r…
7. The ribosome is a complex made up of: A) Proteins and oligosaccharides. B) De
7. The ribosome is a complex made up of: A) Proteins and oligosaccharides. B) Deoxyribonucleic acid and polypeptides. C) rRNA, DNA, mRNA and protein. D) tRNA, mRNA and proteins E)…
7. The sarcolemma is the A. storage site for calcium ions in myofibers B. plasma
7. The sarcolemma is the A. storage site for calcium ions in myofibers B. plasma membrane of a myofiber C. protein that binds oxygen D. separation between sarcomeres in a myofiber…
7. The single strand of DNA shown below can replicate and produce which of the f
7. The single strand of DNA shown below can replicate and produce which of the following strands? DNA: A-T-C-C-G.G-A-T-T-A-C-G A. T-A-C-C-C-C-T-A-A-T-G-C B. T-A-G-G-C-C-T-A-A-T-G-…
7. The single strand of DNA shown below can replicate and produce which of the f
7. The single strand of DNA shown below can replicate and produce which of the following strands? DNA: A-T-C-C-G-G-A-T-T-A-C-G T-A-C-C-C-C-T-A-A-T-G-C B. T-A-G-G-C-C-T-A-A-T-G-C &…
7. The site responsible for orienting the enzyme on the template for translation
7. The site responsible for orienting the enzyme on the template for translation in prokaryotes is ________. whereas the site responsible for orienting the enzyme on the template …
7. The size of a light wave is the distance between two successive \"wave crests
7. The size of a light wave is the distance between two successive "wave crests." This the distance between two points of max intensity of the light wave. What is the name for thi…
7. The sodium–potassium pump is an example of a system that uses primary active
7. The sodium–potassium pump is an example of a system that uses primary active transport to set up conditions that will allow secondary active transport, in this case, of glucose…
7. The spindles disappear. 14. The reverse of prophase. Interphase Prophase Anap
7. The spindles disappear. 14. The reverse of prophase. Interphase Prophase Anaphase Telophase Metap Cytokinesis (2x) Sister Chromatid Centromere Cell Plate 18. In what Phase does…
7. The synthesis of 1 mol palmitate from 1 mol acetyl-C0A requires 14 mol NADPH.
7. The synthesis of 1 mol palmitate from 1 mol acetyl-C0A requires 14 mol NADPH. Some of this NADPH comes from the reaction of malic enzyme, and some from the pentose phosphate pa…
7. The term \"protostome\" erm protostome\" b) the first larvae have the biggest
7. The term "protostome" erm protostome" b) the first larvae have the biggest mouths literally means "first mouth" This refers to the fact that mea the mouth is the first thing yo…
7. The total number of nesting pairs of bald eagles in the lower 48 states in 20
7. The total number of nesting pairs of bald eagles in the lower 48 states in 2006 was 9,789 a. What percent of nesting pairs were located in the 5 identified states? b. What perc…
7. The visible or functional characteristics of an individual usually represente
7. The visible or functional characteristics of an individual usually represented in a word or short descriptive phase is known as the.. a. genotype b. locus c phenotype d. allele…
7. Three Drosophila X-linked recessive genes are y, w, and ct for yellow body, w
7. Three Drosophila X-linked recessive genes are y, w, and ct for yellow body, white eyes and cut wing. A yellow, white-eyed, normal-winged female was crossed with a male with cut…
7. Toxic, Corrosive, Flammable, and Reactive Wastes are all forms of what type o
7. Toxic, Corrosive, Flammable, and Reactive Wastes are all forms of what type of waste? (4pts) 8. List or describe at three of the places that we have considered to be "away" for…
7. True or False. The pollen grains of plants contain the egg cells of the plant
7. True or False. The pollen grains of plants contain the egg cells of the plant. 8. This is the name for the male reproductive structure in a flower. 9. True or False. In plants,…
7. True or false? a) b) Distilled water has no color andtherefore should NOT abs
7. True or false? a) b) Distilled water has no color andtherefore should NOT absorb Solutions used to pl amphipathic CANNOT pass through the selectively permeable phospholipid pla…
7. True/False: Divergent evolutionary paths of descent provide for totally diffe
7. True/False: Divergent evolutionary paths of descent provide for totally different species in similar niches. 8. Photosynthetic organisms (green plants) can continue to photosyn…
7. Two photons are zooming across the Universe. One of them is an ultraviolet ph
7. Two photons are zooming across the Universe. One of them is an ultraviolet photon, while the other is a microwave photon. Which has the greater speed? a.) The ultraviolet since…
7. Understanding Figure 25 -18. Answer a -c using the bold-faced letters O-R in
7. Understanding Figure 25 -18. Answer a -c using the bold-faced letters O-R in the diagram at right. a) Which area(s) represent a universe in which gravity is 2.s stronger than e…
7. We are fighting what seems to be a losing battle against antibiotic-resistant
7. We are fighting what seems to be a losing battle against antibiotic-resistant Gram negative bacteria, such as “beta-lactamase-producing Enterobacteriaeceae” (BLPE). BLPE seemed…
7. We are fighting what seems to be a losing battle against antibiotic-resistant
7. We are fighting what seems to be a losing battle against antibiotic-resistant Gram negative bacteria, such as "beta-lactamase-producing Enterobacteriaeceae" (BLPE). BLPE seemed…
7. Wha t is the minimum possible value for a bifurcation ratio? Please esplain y
7. Wha t is the minimum possible value for a bifurcation ratio? Please esplain your answer. 8. In what way is stream order a function of map scale? 9. A stream network is known to…
7. What are Mendel\'s two principles (laws) of inheritance? How can these princi
7. What are Mendel's two principles (laws) of inheritance? How can these principles be explained by the events of meiosis? For questions 8-18, assume Mendelian rules of inheritanc…
7. What are general transcription factors and combinatorial gene regulation? a.
7. What are general transcription factors and combinatorial gene regulation? a. How does this relate to the 'Proteins outnumber genes' dilemma? Provide an example. b. How does thi…
7. What are sunspots and how are they formed? 8. Describe the sunspot cycle and
7.What are sunspots and how are they formed? 8. Describe the sunspot cycle and how could it effect weather on Earth? 9. Describe a solar prominence. 10 What are solar flares and h…
7. What are the beneficial elements? 8. Diagnosis of nutritional disorder by vis
7. What are the beneficial elements? 8. Diagnosis of nutritional disorder by visible symptoms needs to consider the following A Symptoms D. The patterns of Chlorosis and necrosis …
Subject
Biology and Genetics
Use Browse or pick another subject.