Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse S

Alphabetical listing with fast deep pagination.
53166 items • Page 885 / 1064

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Suppose we are given an m arc, n vertex directed graph and we want to be able to
Suppose we are given an m arc, n vertex directed graph and we want to be able to quickly answer questions of the form: what is the shortest path (in terms of number of edges) from…
Suppose we are given an n-node rooted tree T, such that each node v in T is give
Suppose we are given an n-node rooted tree T, such that each node v in T is given a weight w(v) R +. An independent set of T is a subset S of the nodes of T such that no node in S…
Suppose we are given an unweighted, directed graph G with n vertices (labelled 1
Suppose we are given an unweighted, directed graph G with n vertices (labelled 1 to n), and let M be the n × n adjacency matrix for G (that is, M (i,j) = 1 if directed edge (1J) i…
Suppose we are given complete information about the application for and the time
Suppose we are given complete information about the application for and the time elapsed before issuance of residential building permits in Chicago for the past year. Give one exa…
Suppose we are given four scientific instruments {11, 12, 13, and a space capsul
Suppose we are given four scientific instruments {11, 12, 13, and a space capsule whose payload weight cannot exceed C 12. For each instrument I, let v, and w, denote its scientif…
Suppose we are given n array a of non-negative integers of length n, that is, we
Suppose we are given n array a of non-negative integers of length n, that is, we are using slots 0 through n-1 as usual. As an example, suppose n = 20, and a[0..19] = 14 71 2 11 1…
Suppose we are in a two-period environment where the representative consumer has
Suppose we are in a two-period environment where the representative consumer has a utilit;y function of the form: Let the discount factor, , represent the idea that the consumer v…
Suppose we are in deep space so that there are no other forces to worry about. I
Suppose we are in deep space so that there are no other forces to worry about. I have a 2cm long bar magnet ( this is the 1st magnet ) fixed in place at the origin of a coordinate…
Suppose we are in following code, at line 4. --What is the entry at the top of k
Suppose we are in following code, at line 4. --What is the entry at the top of kernel stack A (old) ? --What is the next entry? --And the next ? --And the next few entries (their …
Suppose we are inserting strings into a hash table of size 9. Suppose we have tw
Suppose we are inserting strings into a hash table of size 9. Suppose we have two hash functions, h, and h2. The hash values for certain strings of these functions are shown in th…
Suppose we are interested in bidding on a piece of land an interested.\' The sel
Suppose we are interested in bidding on a piece of land an interested.' The seller announced that t Assume that the competitor's bid x is a random variable that is uniformly distr…
Suppose we are interested in bidding on a piece of land an interested.\' The sel
Suppose we are interested in bidding on a piece of land an interested.' The seller announced that t Assume that the competitor's bid x is a random variable that is uniformly distr…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested.1 The seller announced that the highest bid in excess of $10,000 will be accepte…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,600 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,800 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,800 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,600 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,100 will be accepted…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,900 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,000 will be accepted…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,400 will be accepted…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,500 will be accepted…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10, 100 will be accepte…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,300 will accepted. A…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,300 will accepted. A…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested.1 The seller announced that the highest bid in excess of $10,000 will be accept­…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,800 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,800 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,600 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $9,500 will be accepted.…
Suppose we are interested in bidding on a piece of land and we know one other bi
Suppose we are interested in bidding on a piece of land and we know one other bidder is interested. The seller announced that the highest bid in excess of $10,400 will be accepted…
Suppose we are interested in bidding on a plece of land and we know one other bi
Suppose we are interested in bidding on a plece of land and we know one other bidder is interested. The seler announced that the highest bid in escess of $10,200wil accepted. Assu…
Suppose we are interested in bidding on undeveloped land in Nevada and reselling
Suppose we are interested in bidding on undeveloped land in Nevada and reselling it for a profit to unsuspecting californians for $16,000. If e know that one other bidder is the o…
Suppose we are interested in determining whether there is a relationship between
Suppose we are interested in determining whether there is a relationship between sex and whether a person feels safe going out into their neighborhood at night. Using the cross-ta…
Suppose we are interested in estimating the average number of customers in the s
Suppose we are interested in estimating the average number of customers in the supermarket. On average, there are 15 customers entering the supermarket every 5 minutes. And on ave…
Suppose we are interested in estimating the difference in mean treatment respons
Suppose we are interested in estimating the difference in mean treatment responses, denoted d, between two medical treatments. We plan to collect data X1, . . . , Xn and Y1, . . .…
Suppose we are interested in estimating the fraction of students who have plagia
Suppose we are interested in estimating the fraction of students who have plagiarized. Instead of asking an embarrassing question directly, we use the technique of "randomized res…
Suppose we are interested in estimating the fraction of students who have plagia
Suppose we are interested in estimating the fraction of students who have plagiarized. Instead of asking an embarrassing question directly, we use the technique of "randomized res…
Suppose we are interested in examining the difference in wages between men and w
Suppose we are interested in examining the difference in wages between men and women and run the following regression: Wage = beta_0 + beta_1 Gender + beta_2 Experience + epsilon …
Suppose we are interested in examining the impact of a new tutoring program on s
Suppose we are interested in examining the impact of a new tutoring program on students' grades on the first midterm exam in introductory economics classes at GSU. Tutors work in …
Suppose we are interested in examining the relationship between AGE and FEV amon
Suppose we are interested in examining the relationship between AGE and FEV among children. We construct the following model: FEVi = 0 + 1 AGEi + i What does 0 represent? the mean…
Suppose we are interested in examining the relationship between AGE and FEV amon
Suppose we are interested in examining the relationship between AGE and FEV among children. We construct the following model: FEVi = 0 + 1 AGEi + i Suppose the coefficient of dete…
Suppose we are interested in investing in one of three investment opportunities:
Suppose we are interested in investing in one of three investment opportunities: d1, d2, or d3. The following profit payoff table shows the profits (in thousands of dollars) under…
Suppose we are interested in investing in one of three investment opportunities:
Suppose we are interested in investing in one of three investment opportunities: d1, d2, or d3. The following profit payoff table shows the profits (in thousands of dollars) under…
Suppose we are interested in mean decay rate of a compound in the Mill River. De
Suppose we are interested in mean decay rate of a compound in the Mill River. Determine the mean decay rate is greater than 3.0 per day. When you test a random sample of size 15, …
Suppose we are interested in studying a DNA sequence which consists of four base
Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G and T. For example: TGCGTGCTACCACATCATGCAGTTTTCAAAG AAGAAAGCCTCACCACAAA. Write a functio…
Suppose we are interested in studying a DNA sequence which consists of four base
Suppose we are interested in studying a DNA sequence which consists of four bases: A, C, G, and T. For example: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCTCACCACAAA. Write a function…
Suppose we are interested in the amount of time college students spend on social
Suppose we are interested in the amount of time college students spend on social networking sites: Facebook, MySpace, and Twitter. We know the amount of time each student spends o…
Suppose we are interested in the behavior or sample mean age of college undergra
Suppose we are interested in the behavior or sample mean age of college undergraduates, for random samples of a certain size. To draw conclusions about the center of the distribut…
Suppose we are interested in the genetic change in two traits: Weight and Feed I
Suppose we are interested in the genetic change in two traits: Weight and Feed Intake. The relative economic values of the traits are 1 for weight and -0.3 for feed intake. Assume…