Response To Questions From Part A To B The amino acid sequence shown in the foll

Question

Response To Questions From Part A To B The amino acid sequence shown in the following table was obtained from the central region of a particular polypeptide chain in the wild-type and several mutant bacterial strains. Amino acid sequence Wild-type Phe- Leu - Pro-Thr- Val - Thr-Thr-Arg- Trp Phe Leu- His His-Gly- Asp- Asp Thr-Val Phe Leu Pro-Thr- Met - Thr-Thr - Arg -Trp Phe-Leu-Pro Thr- Phe-Pro-Pro-Arg Phe Leu-Pro-Ser-Val - Thr- Thr - Arg- Trp 2 Val-Thr -Thr-Arg 4 a) For each mutant, show what single nucleotide change occurredat the DNA level,and indicatewhether the change is a base-pair substitution mutation (missense or nonsense) or a frameshift mutation. b) Based on the collection of mutants, deduce the DNA sequence of the wild-type amino acid sequence.

Explanation / Answer

a.

1. in this mutant first two amino acid are same as of wild type viz Phe,Leu,.

Third amino acid changes from proline to histidine. Here, two cases may be possible. Firstly, CCU coding for proline, at second position, “C” has been substituted with “A” .Hence, this is case of mis-sense mutation. Second case could CCC coding for proline be, in second position “C” has been substituted with “A” and become “CAC” coding for histidine. This is too an example of mis-sense mutation.

At fourth position, Thr is replaced with His. In this case, this is an example of frameshift mutation, where codon for threonine (ACU, ACC, ACA, ACG) has undergone frameshift mutation to form histidine( CAU,CAC).

At fifth position , val is replaced with glycine. Valine is coded by (GUU, GUC, GUA, GUG) has undergone mis-sense mutation to form glycine (GGU, GGC, GGA, GGG).

At sixth position , Thr is replaced with Asp.Threonine (ACU, ACC, ACA, ACG) , replaced with Asp (GAU,GAC) undergone frameshift mutation to form aspartic acid.

At seventh position , same as sixth position substitution.

At eigth position, Arg(CGU, CGC, CGA,CGG) has been replaced with Thr(ACU, ACC, ACA, ACG). This is a example of frameshift muation

At ninth position, Trp(UGG) has been replaced with Valine ((GUU, GUC, GUA, GUG). This is an example of frameshift mutation.

2. In the second mutant, at fifth position valine (GUU, GUC, GUA, GUG) has been replaced with methionine (AUG). This is an example of frameshift mutation. Rest all amino acid are same as wild one.

3. In the third mutant, last amino acid “Trp”(UGG) has been lost. This is so because UGG has been replaced with stop codon(UGA,UAG).

4. In the fourth mutant, at second position, leucine( CUU,CUC,CUA,CUG) has been replace with proline (CCU, CCC,CCA,CCG). This is an example of mis-sense mutation.At fourth position, threonine (ACU, ACC, ACA, ACG) , replaced with Arg(CGU, CGC, CGA,CGG). This is an example of mis-sense mutation. After that ,all amino acid are absent because non-sense mutation have occurred.

5. In the fifth mutant, at fourth position, Thr (ACU, ACC, ACA, ACG) has been replaced with serine(UCU, UCC,UCA,UCG). This is an example of mis-sense mutation. Rest all amino acid are same.

b. DNA sequence of wild type of protein is :

UUUUUACCUACUGUUACUACUCGUUGG

Related Questions

Navigate

• Browse (All)
• Browse R
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.