Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

3. A company has created 3 types of tomatoes: red, pink and white. You want to u

ID: 182244 • Letter: 3

Question

3. A company has created 3 types of tomatoes: red, pink and white. You want to understand why these tomatoes have different colors. You know that the "red" gene contains a SNP in its promoter: The promoter sequence is shown below: the 33rd nucleotide can be an A or a C Because this SNP is in the TATA box of the red gene, you think that depending on whether this nucleotide is an A or a C, the gene will either be expressed (on-red allele) or remain silent (off- white allele). Based on this you generate a hypothesis that can possibly explain why tomatoes have different colors: if the red gene is off, the tomato will be white, if it is on it will be red and if only one allele is on, it will be pink. So you collect red, pink and white tomatoes and do several experiments to see if your hypothesis is true. BspCNI Tsp5091 Apol CviQI SspI MnlI 5.... CCCAAAACCGACTGACTAATATTAGTACTATAAATTTCTGAGGCCCGTGATG .. 3' 3... GGGTTTTGGCTGACTGATTATAATCATGATATTTAAAGACT CCGGGCACTAC ...5' 1 I 10 20 30 40 50 SspI BspONI CviQI Tsp5091 The restriction endonucleases shown above recognize the following sequences: SspI: 5-AATATT-3' CviQI: 5'-GTAC-3' BspCNI: 5'-CTGAG-3' Tsp5091: 5'-AATT-3' Apol: 5'-AAATTT-3' MnlI: 5'-GAGG-3'

Explanation / Answer

1.

1b.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote