Below are the DNA sequences that encode the first eight amino acids for four all

Question

Below are the DNA sequences that encode the first eight amino acids for four alleles of the Adh protein in Drosophila melanogaster. Nucleotides that differ from the first sequence are shown by a lowercase letter.

ATGTCTCTCACCAACAAGAACGTC

ATGgCTCTCACCAACAAGAACGTC

ATGTCgCTCACCAACAAGAACGTC

ATGTCTtTgACCAACAAGAACGTC

a. What are the first eight amino acids for each of these four DNA sequences?

b. For each of the four polymorphic sites, indicate whether the site represents a synonymous or nonsynonymous polymorphism.

c. Synonymous polymorphisms tend to be more common than nonsynonymous ones. Why might that be?

I mostly need help with question “C.” So if anything please answer question “C”!!

Explanation / Answer

Ans c: There are always more synonymous mutations that non synonymous mutations. Synonymous does not result in protein coding changes (does not change amino acid coding). Non synonymous does change amino acid coding

Synonymous substitutions: mutations that do not result in a changed amino acid sequence of the protein that they encode. They are neutral or very close to neutral. Nonsynonymous substitutions: change the amino acid sequence. Are not neutral because they change the way that a protein functions, and such changes have fitness consequences.

Substitutions in noncoding regions (pseudogenes, introns, sections between genes that are not regulatory): are synonymous mutations. only a small fraction of the genome encodes the sequence of proteins. The rest is untranslated. Mutations in these untranslated regions most likely will have very minor effects or even no effect on function and fitness

Both types of mutations are expected to arise at the same rate. However, synonymous substitutions do not change the amino acid sequence of a protein and generally have no phenotypic effect. They are not subject to natural selection and are expected to accumulate freely. While the nonsynonymous substitutions do change the amino acid sequence and potentially have a wide range of affects on phenotype. These effects are subject to natural selection. Most nonsynonymous substitutions will be at least slightly harmful and selected against reducing their frequency while a few will be nearly neutral or advantageous so nonsynonymous mutations will tend to accumulate much more slowly and be fixed at a lower rate than synonymous ones. This general tendency would not change from gene to gene, so the effect would be expected to occur for most genes.

Because the ratio of nonsynonymous to synonymous polymorphisms is relatively high, the gene being studied may encode a protein tolerant of substitution. The relatively fewer species differences may suggest that speciation was a recent event, so few polymorphisms have been fixed in one species that are not variants in the other.

Related Questions

Navigate

• Browse (All)
• Browse B
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.