Chrome File Edit View History Bookmarks People Window Help 4) us. 100%Sun Mar 11

Question

Chrome File Edit View History Bookmarks People Window Help 4) us. 100%Sun Mar 11 11:39 PM Q E Take BIO314 2rn Secure https://portal.utoronto.ca/webapps/assessment/take/launch.jsp?course-assessment_id=-161651-1&course-ide-92; 7293_1&new-attempt; a : Apps Maria Robinson qu…Watch Arsenal vs s.. r Sports TV 1-Wate.. Management l Ran, m Fred Perry Footwea V sports-Live Video CE is.byu.edu/courses. o -Other Bookmarks Question Completion Status: QUESTION 4 1 points Save Answer A PCR primer has the following sequence: 5 CATCCCCTAGGGTCACATAG 3. From the list below, select all the design flaws that are applicable to this primer Primer is not long enough The GC coment of the primer is too high The primer contains a substantial seit-complementary region. The melting temperature of the primer lies outside the ideal range The 3' end of the primer does not comtain enough Cs or Gs. QUESTION 5 1 points Save Answer In comparison to a standard PCR reaction, Sanger sequencine reactions contain dideonynucleotides instead of deoxynuclectides True False QUESTION 6 1 points Save Answor Which of the following sequendine methods use[s) dNTPS, known as "revers ble terminators," that contain polymerization blocking eroups, which are removed after each round of synthesis and detection to allow further nucleotide addition. Automated Sanger sequencing dord Nanopore 1,3&4 Single Molecule Real Time (SMRT None of the above QUESTION 7 1points Save Answer In the 17 expression system, IPTG is used to induce expression of bacterially encoded T? RNA polymerase, which in turn transcribes a plasmid encoded target gene located downstream of the T7 promater True Falso QUESTION 8 5 points Savo Answor Cick Sove and Submit to s0ve ard sthmit. Csck Sqve AM Answers to suve al anawers Sawe Al Anewera Save and Submit

Explanation / Answer

Question 4

Question 5

Explanation: In Sanger sequencing chain termination method dideoxynucleotides are used which lacks the hydroxyl group. So it is unable to form the phosphodiester bond with the incoming nucleotide.

Question 6

Question 7

Related Questions

Navigate

• Browse (All)
• Browse C
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.