Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Assignment Appendix: Genetic code The following shows the sequence of the coding

ID: 271045 • Letter: A

Question

Assignment

Appendix: Genetic code
The following shows the sequence of the coding strand of the gene for  tRNAGlu from the
single-celled eukaryot tetrahymena. The three highlighted nucleotides in the sequence correspond to the anticodon in tRNAGlu.

1) Write down the sequence of anticodons in tRNAGlu from Tetrahymena clearly indicating 5'- and 3'-ends. Which (c) codons can this anticodon base pair with? What
specifies this / these codons (s) in the common genetic code? (See Appendix).
2) It is possible to produce extracts from human cells that contain all components necessary for protein synthesis, except for mRNA. If you add human mRNA to such extracts, proteins are formed corresponding to the added mRNA. Adding mRNA from Tetrahymena to this type of human cell extract, many of the proteins formed become too short. Why?
3) If human tRNAGlu is replaced by Tetrahymena in the human cell extract tRNAGlu, normal Tetrahymena proteins can be formed by addition of Tetrahymena mRNA. Assumes that human glutamyl tRNA is also replaced synthetase with Tetrahymena glutamyl tRNA synthetase? The answer must be justified.

GTTCCATAGTATAGTGGTTAGTACTGGGGACTTTAAATCCCTTGACCTGGGTTCGA ATCCCAGTGGGACC-3'

Explanation / Answer

1. Sequence of the anticodon will be 5' TTU 3

This anticodon will pair with the codons present in the mRNA 3' UUA 5',with watson crick base pairing. The third base in the codon and first base in the anticodon show wobbling forming alternative base pairing.

E.G if first base in the anticodn is U , then it can base paair with any A or G.

The correct codon anticodon base pairing is specified by complementary base pairing between nucleotides. These codon are specified in the genetic code via attachment of correct amino acid to the tRNA molecule,thisis facilitated by amino acyl tRNA synthetases, which are specific for each amino acid. They mediate the recognition of correct tRNA and amino acid before attaching them.

2) No ,it is not possible to synthesize extract in absence of mRNA, since the amino acids are added for polypeptide synthesize only when codons present in the mRNA are read by the tRNA molecule.

IF we provide modified synthetic mRNA or human mRNA then protein synthesis will start.

Addition to mRNA from tetrahymena to human cell extracts will lead to short proteins because of the codon preferences, since tetrahymena mRNA differs from human mrRNA ,having different codon composition.

They use TAA and TAG codon as glutamine codon whereas in human it is stop codon , thus it poses codon differences.

3)Replacing tRNAGlu from human by tetrhymena tRNAGlu and tetrahymena mRNA is provided , then tetrahymena proteins will be synthesized. The possibility is that when the entire machinery is replaced including mRNA, tRNAGlu , tRNA synthetase then normal protein synthesis will take place irrespective of the host system(human cells or any other). Since now codon and anticodon base pairing will happen correctly, no codon difference will arise since mRNA and tRNA both are provided. In addition to this tRNA synthetase will mediate the recognition and perform attachment of correct amino acidonto the tRNA.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote