You are studying DNA synthesis using a biochemical assay. Your assay system cont

Question

You are studying DNA synthesis using a biochemical assay. Your assay system contains everything DNA polymerase needs to synthesize DNA. The double-stranded DNA molecule used for your assay has the following sequence: 5' AAATTGGGCCATCATTTCGAGTATTOGACTCCCTAGATcc.... 3 3' TTTAACCCGGTAGTAAAGCTCATAAGCTGAGGGATCTAGG... 5. You denature the above molecule by heating (i.e. separate the double helix into two single-stranded DNA molecules), and cool it down in the presence of the primer 5' GGGAGTCGAAT 3' which base pairs (hybridizes) to one of the two strands. To this mixture you now add DNA polymerase, dATP, dCTP, dGTP, and dTTP and a new DNA strand is synthesized. Write the complete sequence of the new single strand of DNA (including the primer sequence) that will be synthesized in the above reaction. Be sure to label the 5' and 3' ends of this sequence.

Explanation / Answer

Answer:

Complete sequence of the new single strand of DNA is: 5’GGGAGTCGAATACTCGAAATGATGGCCCAATTT3'

After denaturaction of the strands and add the primer to the mid of , it start from 5' to 3' direction toward the 5' of the template strand

As new bases added to the 3' end of the molecule. The primer given in question match to a sequence that is in the middle of the larger sequence and new bases can be added to the 3' end .

Related Questions

Navigate

• Browse (All)
• Browse Y
• Subjects

---

---

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.