Below is a piece of DNA, and under that in BOLD is the RNA that was produced fro
ID: 81092 • Letter: B
Question
Below is a piece of DNA, and under that in BOLD is the RNA that was produced from that DNA. 5' AGCGCTATGCTGCGATGCTGCCAGCATGTCTGATTCTGACTGGCTGCTGACTTGATCGTATAAGCCG3' 3'TCGCGATACGACGCTACGACGGTCGTACAGACTAAGACTGACCGACGACTGAACTAGCATATTCGG C5 ' 5' UGCUGCCAGCAUGUCUGAUUCUGACUGGCUGCUGACUUGAUCGUA UAAGCCG 3' On the DNA strand label a) The template strand and the coding strand b) The promoter region c) The +1 site On the mRNA label a) The 5' UTR. b) The 3' UTR. Translate the mRNA above into protein. Mandibuloacral dysplasia is a rare autosomal recessive syndrome characterized by mandibular hypoplasia and delayed cranial suture closure. One of the mutations that results in the disease changes the TEMPLATE strand of the DNA from 3' GCA 5' in normal individuals to 3' GAA 5' in mutant individuals. What amino acid is present in the normal protein in this location, and what is present in the mutant individuals?Explanation / Answer
1) On the DNA strand label
Ans. a) The Bottom strand is template strand and template strand refers to the sequence of DNA that is copied during the synthesis of mRNA and the top strand is coding strand or the mRNA-like strand in which base directly corresponding to the mRNA sequence.
b) The promoter is a region of DNA that initiates transcription of a particular gene, the bottom strand left side is promotor region or left side from transcription initiation side.
c) Transcription start site is +1 site. just after promotor region.
2) On the mRNA label
5' UGCUGCCAGC AUGUCUGAUUCUGACUGGCUGCUGACUUGAUCGUA UAAGCCG 3'
Ans. a) The 5' UTR untranslated region (5UTR), the region between the 5' capping and transcription initiation codon
Ans. b) The 3 untranslated region (3UTR), the region between the stop codon and the start of the poly(A) tail.
Ans. 3) TACAGACTAAGACUGACCGACGACUGAACUAGCAU
Ans. 4) GAC present in the normal protein and AGA in mutant individual
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.