Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Chapter 16 Question 13 Recall that DNA and RNA are synthesized only in the 5\'?

ID: 811009 • Letter: C

Question

Chapter 16 Question 13

Recall that DNA and RNA are synthesized only in the 5'? 3' direction and that DNA and RNA sequences are written in the 5'? 3' direction, unless otherwise noted.

Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A

Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

5'  3'

Part B

Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp

Explanation / Answer

mRNA sequence,

Start codon                                                  End codon

AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG

Amino acid sequence

The amino acid sequence can be read from the codon table by replacing Uracyl with Thiamine

meth-pro-val-trp-arg-ser-gly-tyr-ser.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote