Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

13. Which of the following sequences contain a six-nucleotide inverted repeat? (

ID: 81123 • Letter: 1

Question

13. Which of the following sequences contain a six-nucleotide inverted repeat?

(a) GTCACGCGACGATACGGTCACG

(b) GTCACGACTAGCCTAGTCGCTG

(c) GTCACGACTAGCCATCAGCCTG

(d) GTCACGACTAGCCCGACTAGTG

15. Which of the following is not true of the regulation of translation initiation in eukaryotes?

(a) Repressors bind to the 3' untranslated region of mRNA.

(b) Repressors bind to initiation factors.

(c) Repressors bind to translational start sites of mRNA.

(d) Repressors bind to translational release factors.

16. The 5' upstream regions of transcriptionally active genes generally do not exhibit which of the following characteristics?

(a) contain binding sites for known regulatory proteins

(b) relatively fewer nucleosomes

(c) increased in vitro sensitivity to DNase I

(d) increased concentration of histone H1

Explanation / Answer

answers:

14) a

15) D

answer: Repressors bind to translational release factor

16) b

answer: relatively fewer nucleosomes

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote