Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 123 / 2033

1. The elevation of the abyssal ocean floor decreases, relatively smoothly, with
1. The elevation of the abyssal ocean floor decreases, relatively smoothly, with distance away from a mid-ocean ridge spreading center. Why is this? If the rate of spreading at a …
1. The elucidation of the regulatory mechanisms associated with the enzymes of l
1. The elucidation of the regulatory mechanisms associated with the enzymes of lactose utilization n E.coli was a landmark in our understanding of regulatory processes in microorg…
1. The energy required for tubular polymerization is provided by the hydrolysis
1. The energy required for tubular polymerization is provided by the hydrolysis of GTP. A) True B) False 2. Which of the following statements is correct with respect to flagella a…
1. The enzyme PspN4I cleaves the sequence GG/NNCC (N= any of the four bases). Ho
1. The enzyme PspN4I cleaves the sequence GG/NNCC (N= any of the four bases). How many times would you expect PspN4I to digest a 30 kb genome? Round off to the nearest whole numbe…
1. The enzyme streptokinase_______ A. Lyses red blood cells B. Dissolves fibrin
1. The enzyme streptokinase_______ A. Lyses red blood cells B. Dissolves fibrin clots C. Causes fibrin clots to form D. Destroys white blood cells 2. Which of the following pairin…
1. The equation is the definition of population average fitness 2 the symbol u r
1. The equation is the definition of population average fitness 2 the symbol u refers to the mutation rate toward seltoviekt neutral mutations 3 the symbol u refers to the mutatio…
1. The estimated rate at which supernova explosions occur in our Galaxy is Selec
1. The estimated rate at which supernova explosions occur in our Galaxy is Select one: a. about once every 5 years. b. about once every 5000 years. d. about once every 50 years. 2…
1. The exchange surface in the alveoli is normally: a very thick layer to protec
1. The exchange surface in the alveoli is normally: a very thick layer to protect the body from inhaled bacteria or viruses. is composed of surfactant, Type I alveolar cells, a fu…
1. The excretory system helps regulate a. water content of the body b. blood vol
1. The excretory system helps regulate a. water content of the body b. blood volume of the body c. pH of the body d. all of the above e. none of the above 2. Which excretory organ…
1. The exponential nature of PCR allows spectacular increases in the abundance o
1. The exponential nature of PCR allows spectacular increases in the abundance of a DNA sequence being amplified. Consider a 10-kbp DNA sequence in a genome of 10^10 base pairs. 2…
1. The expression of a gene may include: A) transcription B) translation C) repl
1. The expression of a gene may include: A)        transcription B)        translation C)        replication D)        both A and B E)        A, B, and C 2. __________ is the prod…
1. The expression of a gene may include: A) transcription B) translation C) repl
1. The expression of a gene may include: A)        transcription B)        translation C)        replication D)        both A and B E)        A, B, and C 2. __________ is the prod…
1. The expression of genes is regulated in S. pneumoniae positive and negative r
1. The expression of genes is regulated in S. pneumoniae positive and negative regulators that respond to signals from the environment. a. How can the presence or absence of gluco…
1. The eye color of wild-type Drosophila flies is red. Different mutations in a
1. The eye color of wild-type Drosophila flies is red. Different mutations in a single or in multiple genes lead to flies with white eyes. Mutations in the w gene on the X chromos…
1. The facial bones number in total Show Answer a. 15 b. 12 C. 14 d. 10 2. The c
1. The facial bones number in total Show Answer a. 15 b. 12 C. 14 d. 10 2. The cap-like superior portion of the skull that protect the brain is known as the Vomer, Calvaria, Sphen…
1. The family in the pedigree below contains many individuals with Huntington\'s
1. The family in the pedigree below contains many individuals with Huntington's disease Huntinton's is a monogenic trait conferred by a dominant allele (H) of the huntingtin gene …
1. The field of Health Informatics is involved in studies where technology is be
1. The field of Health Informatics is involved in studies where technology is being used to handle “Big Data," bringing about unlimited potential for information growth. Data mini…
1. The figure above uses unit of PgC or PgC/yr, whereas other figures use ppm fo
1. The figure above uses unit of PgC or PgC/yr, whereas other figures use ppm for atmospheric concentrations (and ppm/yr for trends). 2.12 PgC is approximately 1 ppm. Convert the …
1. The figure below illustrates one level of protein structure. This structure i
1. The figure below illustrates one level of protein structure. This structure is held together by the bonds labeled #1. Examine this structure and use it to answer questions a-f …
1. The figure below shows a phase of mitosis. Which cell structures are indicate
1. The figure below shows a phase of mitosis. Which cell structures are indicated by the letter X? Chromosomes Centrioles Kinetochore microtubules. Centrosomes Centromeres 2. The …
1. The figure below shows a phase of mitosis. Which cell structures are indicate
1. The figure below shows a phase of mitosis. Which cell structures are indicated by the letter X? Chromosomes Centrioles Kinetochore microtubules. Centrosomes Centromeres 2. The …
1. The figure below shows an elevation map of a portion of the Outer Banks of No
1. The figure below shows an elevation map of a portion of the Outer Banks of North Carolina, by Cape Hatteras, in 2008. Elevations are given in half meter increments as shown in …
1. The figure below shows the global temperature anomaly in °C from 1850 to 2012
1. The figure below shows the global temperature anomaly in °C from 1850 to 2012, relative to the 1961-1990 average temperature, determined from 3 different global temperature dat…
1. The figure to the right shows what happened in fl ask #9 in Dr. Lenski’s stud
1. The figure to the right shows what happened in fl ask #9 in Dr. Lenski’s studies. Based on this fi gure: a. What does OD mean and what does it represent? b. What do higher OD v…
1. The figures in this paper each correspond to the results from entirely differ
1. The figures in this paper each correspond to the results from entirely different experiments, asking entirely different questions. For both figures, explain WHY the experiment …
1. The final stages of T cell development occur in the thymic medulla, after the
1. The final stages of T cell development occur in the thymic medulla, after the developing cells become CD4 or CD8 single-positive. One important change that occurs during this f…
1. The first is movement through a semi-permeable membrane. 2. The third is thro
1. The first is movement through a semi-permeable membrane. 2. The third is through a semi-solid (agarose) medium, and finally through a living membrane. 3. Finally through a livi…
1. The first paper to demonstrate different chromatin structures in active and i
1. The first paper to demonstrate different chromatin structures in active and inactive genes used nucleases to probe the globin loci in chicken red blood cells, which express glo…
1. The first step in initiation of transcription is the recognition of the promo
1. The first step in initiation of transcription is the recognition of the promoter region in DNA by base pairing with a short RNA sequence inside of RNA polymerase. 2. Locating t…
1. The first step in this lab involved gross observation of several characterist
1. The first step in this lab involved gross observation of several characteristics. After that, you followed it with the Enterotube test. Many times, between these two steps, a s…
1. The first three nucleotides of a six nucleotide palindromic restriction site
1. The first three nucleotides of a six nucleotide palindromic restriction site are GTC; what are the next three? (Note: only bases in one DNA strand are shown) A. GCT B. GTC C. C…
1. The first three nucleotides of a six nucleotide palindromic restriction site
1. The first three nucleotides of a six nucleotide palindromic restriction site are GTC; what are the next three? (Note: only bases in one DNA strand are shown) A. GCT B. GTC C. C…
1. The flexor digitorum superficialis muscle ( that moves the fingers) is found
1. The flexor digitorum superficialis muscle ( that moves the fingers) is found a. in the anterior arm b. in the posterior arm c. in the anterior hand d. in the posterior hand 2. …
1. The flow of protons during the light reaction of photosynthesis is from thyla
1. The flow of protons during the light reaction of photosynthesis is from thylakoids space to storms and back to thylakoids space through the ATPase? True or False? 2. Which of t…
1. The fluid mosaic model governs the diffusion of which of the following bioche
1. The fluid mosaic model governs the diffusion of which of the following biochemicals? A. CoQ B. steroids C. phospholipids D. sphingolipids E. all of these biochemicals 2. The co…
1. The flux that removes excess calcium from the ocean basins is ________. A) ev
1. The flux that removes excess calcium from the ocean basins is ________. A) evaporation C) subduction B) sedimentation of calcium carbonate D) reaction with sodium 2. What propo…
1. The following DNA contains one transcribed region which includes 2 exons and
1. The following DNA contains one transcribed region which includes 2 exons and a single 10-nucleotide intron. The transcription start site, (+1, cytosine) and branch point (adeni…
1. The following are all assumptions of the Transtheoretical Model except...? A.
1. The following are all assumptions of the Transtheoretical Model except...? A. Specific processes of change should be emphasized at specific stages B. Intentions always lead to …
1. The following are common features of the central dogma, except....... . 1. DN
1. The following are common features of the central dogma, except....... . 1. DNA 2. RNA 3. proteins 4. control mechanisms 5. increased mutation 2. The following are associated wi…
1. The following cells can be classified as a type of granulocyte, except …………….
1. The following cells can be classified as a type of granulocyte, except ……………. . 1. eosinophils 2. basophils 3. neutrophils 4. alkalophils 2. Features of an acute inflammatory r…
1. The following diagram shows a portion of a long double-stranded DNA template
1. The following diagram shows a portion of a long double-stranded DNA template molecule. The... in the middle of the template molecule represents 1000 base pairs that are omitted…
1. The following diagrams show 4 disease pedigrees. State the mode of inheritanc
1. The following diagrams show 4 disease pedigrees. State the mode of inheritance depicted by each dominant or recessive; and autosomal or sex-linked and explain why you decided a…
1. The following five proteins, which are listed with their molecular weights an
1. The following five proteins, which are listed with their molecular weights and isoelectric points, were separated by SDS-PAGE. Give the order of their migration from the top to…
1. The following graph depicts the results after injection with a subunit vaccin
1. The following graph depicts the results after injection with a subunit vaccine and the second peak indicates a booster dose with the same vaccine. Interpret the graph and answe…
1. The following information applies to questions 1-4. In January 2000 you began
1. The following information applies to questions 1-4. In January 2000 you began a one-year study of tuberculosis (TB) in a subsidized housing community in the Lower East Side of …
1. The following is a DNA sequence that we want to amplify using PCR 5’CTCGAGGTG
1. The following is a DNA sequence that we want to amplify using PCR 5’CTCGAGGTGAATATGAAAG---Gene of-- CATTTGGCGCGTAATCGATA3’ 3’GAGCTCCACTT ATACT TTC---interest-- GTAAACCGCGCATTAG…
1. The following is a DNA sequence that we want to amplify using PCR 5’CTCGAGGTG
1. The following is a DNA sequence that we want to amplify using PCR 5’CTCGAGGTGAATATGAAAG---Gene of-- CATTTGGCGCGTAATCGATA3’ 3’GAGCTCCACTT ATACT TTC---interest-- GTAAACCGCGCATTAG…
1. The following is a short segment of an mRNA molecule. The polypeptide it code
1. The following is a short segment of an mRNA molecule. The polypeptide it codes for is also shown: 5' AUGGUGCUGAAG 3': methionine-valine-leucine-lysine A mutation in the DNA occ…
1. The following is a small stretch of nucleotide sequence from a bacterial mRNA
1. The following is a small stretch of nucleotide sequence from a bacterial mRNA: 5’ – GGGCCCUGAUGUAACAUAGAUAGG – 3’ A. What is the sequence of the DNA template from which it was …
1. The following mini-protein is dissolved in a buffer at pH = 9. What is its NE
1. The following mini-protein is dissolved in a buffer at pH = 9. What is its NET charge at this pH? YOU NEED TO SHOW YOUR WORK FOR LEU, GLU AND LYS (the structures and pKa values…