Biology and Genetics

You use the primer 5\' GCCTCGAATCGGGTACC 3\' to sequence part of a human DNA ins

You use the primer 5' GCCTCGAATCGGGTACC 3' to sequence part of a human DNA insert of a recombinant DNA molecule made with a plasmid vector. The result of the automated Sanger sequ…

You use the primer 5\' GCCTCGAATCGGGTACC 3\' to sequence part of a human DNA ins

You use the primer 5' GCCTCGAATCGGGTACC 3' to sequence part of a human DNA insert of a recombinant DNA molecule made with a plasmid vector. The result of the automated Sanger sequ…

You visit a huge city with millions of people. If you were to start sampling the

You visit a huge city with millions of people. If you were to start sampling the cystic fibrosis allele from one generation to the next, what should happen to its frequency over t…

You visit an area that is extensively covered by this community and are impresse

You visit an area that is extensively covered by this community and are impressed. One of the species exhibits classic metapopulation dynamics. Discuss (fully define) metapopulati…

You visit the site the following year (we will call this “year 2”)and find that

You visit the site the following year (we will call this “year 2”)and find that a massive rock slide from a cliff above has swept down the slope, removing all the plants and soil …

You volunteer with a nonprofit organization that works to connect low income pop

You volunteer with a nonprofit organization that works to connect low income populations with health care resources. The volunteer coordinator expressed an intrest in determining …

You wake up one night to find some small bats drinking your blood and peeing on

You wake up one night to find some small bats drinking your blood and peeing on you. Assuming that you live in Colorado at high elevation, which of the following would you expect …

You walk into the birthing center at the beginning of your shift and look at the

You walk into the birthing center at the beginning of your shift and look at the listing of clients who are in the birthing area. The list looks like this: Name GP Gestation Dilat…

You want see for yourself how mRNA behaves in a eukaryotic cell. You add radioac

You want see for yourself how mRNA behaves in a eukaryotic cell. You add radioactive UTP to the cell medium in two separate dishes. After a short amount of time, you add a large e…

You want to add D-methionine to liquid cultures of E. coli that you have grown o

You want to add D-methionine to liquid cultures of E. coli that you have grown overnight to see if this unusual amino acid affects the growth rate of bacteria. To test this, you m…

You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA usin

You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA using PCR.  The sequence of the two ends of the coding strand is as follows: 5’- CTCCATGGTAAACTTGTACT .…

You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA usin

You want to amplify a 2.1 kb portion of your favorite gene from genomic DNA using PCR.  The sequence of the two ends of the coding strand is as follows: 5’- CTCCATGGTAAACTTGTACT .…

You want to amplify a 21,666 bp-long fragement of human DNA using PCR. You desig

You want to amplify a 21,666 bp-long fragement of human DNA using PCR. You design a pair of primers that are 21 and 23 bases in length (respectively), have identical melting tempe…

You want to amplify a specific DNA sequence from an influenza virus. Which of th

You want to amplify a specific DNA sequence from an influenza virus. Which of the following is necessary for the amplification of this DNA by PCR but not necessary for amplificati…

You want to amplify the DNA between the stretch of sequence shown in the figure

You want to amplify the DNA between the stretch of sequence shown in the figure below. Of the listed primers chose the pair that will allow you to amplify the DNA by PCR. A. Forwa…

You want to amplify the sequence below using PCR. The sequence shown in red repr

You want to amplify the sequence below using PCR. The sequence shown in red represents the sequence that MUST be included in the amplified product, though any flanking sequence is…

You want to analyze DNA samples on an agarose gel. Before loading the sample int

You want to analyze DNA samples on an agarose gel. Before loading the sample into the gel, you need to add loading buffer. The concentration of the stock loading buffer (LB) is 6X…

You want to apply 50 lbs N per acre and 10 lb P2O5 per acre to a 123 acre potato

You want to apply 50 lbs N per acre and 10 lb P2O5 per acre to a 123 acre potato field. You will be using fertigation. The center pivot irrigation system you are working at can co…

You want to artificially produce an enzyme, protein A, through genetic-engineeri

You want to artificially produce an enzyme, protein A, through genetic-engineering. Although you can get your "engineered" bacteria to produce large quantities of A, the product i…

You want to artificially produce an enzyme, protein A. through genetic-engineeri

You want to artificially produce an enzyme, protein A. through genetic-engineering. Although can get your "engineered" bacteria to produce large quantities of A, the product is in…

You want to assess the graft rejection capacity of different MHC molecules in fe

You want to assess the graft rejection capacity of different MHC molecules in female mice. You plan to use 5 mouse strains (S1-S5), which are genetically identical except various …

You want to clone geneX. To do this, you want to ligate the ORF of geneX into pl

You want to clone geneX. To do this, you want to ligate the ORF of geneX into plasmid Y. Plasmid Y contains the sequence (5'-AAGCTT-3') which is the recognition site for the restr…

You want to clone the EGFP insert but using a different vector (instead of pET-4

You want to clone the EGFP insert but using a different vector (instead of pET-41a). The vector you use has the Lacz gene and you use directional cloning to clone the insert into …

You want to confirm the movement of oxygen atoms through the photosynthetic reac

You want to confirm the movement of oxygen atoms through the photosynthetic reactions. You can radiolabel with O^18 isotopes, and provide the plants with 1) radiolabeled H_2O_18 o…

You want to create a point mutation in you PCR product by modifying one nucleoti

You want to create a point mutation in you PCR product by modifying one nucleotide in Primer 1. This means that the primer/template binding at one nucleotide will not be complemen…

You want to create a presence on social media for the cafe. Create a CRM strateg

You want to create a presence on social media for the cafe. Create a CRM strategy for doing business in the virtual world. Here are a few questions to get you started: How can you…

You want to create a sparkly-eyed, zebra striped gecko double mutant, so you cro

You want to create a sparkly-eyed, zebra striped gecko double mutant, so you cross 2 homozygous mutatants together to create F1 geckos that are heterozygous for both mutations. (N…

You want to cut 1 microgram of a plasmid with 4 units of the restriction enzyme

You want to cut 1 microgram of a plasmid with 4 units of the restriction enzyme HindIII for two hours at each of five different temperatures: 10 degrees celsius, 20 degrees celsiu…

You want to cut 1 microgram of a plasmid with 4 units of the restriction enzyme

You want to cut 1 microgram of a plasmid with 4 units of the restriction enzyme HindIII for two hours at each of five different temperatures: 10 degrees celsius, 20 degrees celsiu…

You want to design a cancer killing virus that specifically detect cancer cells

You want to design a cancer killing virus that specifically detect cancer cells miRNA profile and produces a toxin gene call Bax, which is express by CMV promoter. You will develo…

You want to determine if a bacterial species has a similar DNA sequence to anoth

You want to determine if a bacterial species has a similar DNA sequence to another bacteria. The sequence may also serve as a replicator. You isolate genomic DNA from the species …

You want to determine the linear order and genetic distance between three genes

You want to determine the linear order and genetic distance between three genes on chromosome II in Drosophila. The recessive mutant alleles are g. m, and o. You cross heterozygou…

You want to determine the linear order and genetic distance between three genes

You want to determine the linear order and genetic distance between three genes on chromosome II in Drosophila. The recessive mutant alleles are g, m, and o. You cross heterozygou…

You want to determine the linear order and genetic distance between three genes

You want to determine the linear order and genetic distance between three genes on chromosome II in Drosophila. The recessive mutant alleles are g, m, and o. You cross heterozygou…

You want to draw a linkage map for three genes in the fruit fly ( A , b , C ) th

You want to draw a linkage map for three genes in the fruit fly (A, b, C) that you suspect are linked. You have done a three-point testcross and found the following: in the 1500 p…

You want to engineer a yeast cell to manufacture and secrete a bacterial protein

You want to engineer a yeast cell to manufacture and secrete a bacterial protein product To do this properly, you need to make certain that the appropriate signal sequence is pres…

You want to express a rare human protein in bacteria so that you can make large

You want to express a rare human protein in bacteria so that you can make large quantities of it. To aid in its purification, you decide to add a stretch of six histidines to the …

You want to find out why apoptosis fails to occur in several cell lines derived

You want to find out why apoptosis fails to occur in several cell lines derived from tumors. To identify differences between the tumor cell lines (T1, T2, and T3) and a control ce…

You want to identify where a peroxisome-targeting signal sequence is in a yeast

You want to identify where a peroxisome-targeting signal sequence is in a yeast protein called thiolase. To do so, you create a set of hybrid proteins that contain different parts…

You want to identify where a peroxisome-targeting signal sequence is in a yeast

You want to identify where a peroxisome-targeting signal sequence is in a yeast protein called thiolase. To do so, you create a set of hybrid proteins that contain different parts…

You want to increase fruit diameter in tomatoes, and you want to estimate herita

You want to increase fruit diameter in tomatoes, and you want to estimate heritability for this trait. You measured the diameter of tomatoes in two inbred lines, the F1 hybrid bet…

You want to know whether or not serotonin selective reuptake inhibitors (SSRIs)

You want to know whether or not serotonin selective reuptake inhibitors (SSRIs) like Prozac decrease sex drive in men. You have 100 subjects to work with. Would it be better to ha…

You want to know whether the gene for hair color in cats is autosomal or sex-lin

You want to know whether the gene for hair color in cats is autosomal or sex-linked. You should assume that: A. Only one gene controls hair color in cats. B. There are only 2 alle…

You want to make a genomic library of the human genome. So, you will need to cho

You want to make a genomic library of the human genome. So, you will need to choose an enzyme that will digest the DNA that will extensively cut the genome. It is known that appro…

You want to make a genomic library of the human genome. So, you will need to cho

You want to make a genomic library of the human genome. So, you will need to choose an enzyme at will digest the DNA that will extensively cut the genome. It is known that approxi…

You want to make a monoclonal antibody that recognizes the OG protein but not th

You want to make a monoclonal antibody that recognizes the OG protein but not the PO protein. Therefore, a "OG - specific monoclonal antibody". To do this, you purify both OG and …

You want to make a transgenic mouse. The xyz gene is normally expressed in every

You want to make a transgenic mouse. The xyz gene is normally expressed in every cell of the embryo. You fuse the promoter (Pxyz, 300 bp) for the xyz gene to the DNA sequence enco…

You want to map the H2A acetylation site for your HAT (a recombinant histone ace

You want to map the H2A acetylation site for your HAT (a recombinant histone acetyltransferase, which transfers an acetyl group from acetyl-CoA to a Lys side chains on histone H2A…

You want to produce plasmid A in bacteria. You ask your friend to give you plasm

You want to produce plasmid A in bacteria. You ask your friend to give you plasmid A. He gives you the plasmid, however, your friend has digested plasmid A with a single restricti…

You want to purify large amounts of a human tumor suppressor protein called Tusu

You want to purify large amounts of a human tumor suppressor protein called Tusup for biochemical studies. The easiest and cheapest way to achieve this is to place the Tusup gene …