Biology and Genetics
101624 questions • Page 37 / 2033
1 You are a studying the progression of cells through the cell cycle. You are pa
1 You are a studying the progression of cells through the cell cycle. You are particularly interested in the cyclins E and A, both of which contribute sequentially to the same cel…
1 You are a studying the progression of cells through the cell cycle. You are pa
1 You are a studying the progression of cells through the cell cycle. You are particularly interested in the cyclins E and A, both of which contribute sequentially to the same cel…
1 You have a candidate gene which is likely expressed in the nucleus. Design exp
1 You have a candidate gene which is likely expressed in the nucleus. Design experiments to verify this using two different methods. 2. The cytoskeleton is a dynamic three-dimensi…
1 You have attempted to ligate a 1.5 kb fragment of foreign DNA into the EcoRI s
1 You have attempted to ligate a 1.5 kb fragment of foreign DNA into the EcoRI site in the multiple cloning site of the 4.0 kb plasmid vector shown below Recombinant DNA technolog…
1 Your laboratory is in charge of overseeing the QC program for the glucometers
1 Your laboratory is in charge of overseeing the QC program for the glucometers (POCT) in use in your hospital. You notice that the ward staff is not following proper procedure fo…
1 _____ Imagine eating a Snickers Bar (named for a favorite horse, Snickers , of
1 _____ Imagine eating a Snickers Bar (named for a favorite horse, Snickers, of Frank Mars who invented the tasty candy in 1930 – Mmmm Snickers Bars)… OK, imagine eating a Snikers…
1 _____ Imagine eating a Snickers Bar (named for a favorite horse, Snickers , of
1 _____ Imagine eating a Snickers Bar (named for a favorite horse, Snickers, of Frank Mars who invented the tasty candy in 1930 – Mmmm Snickers Bars)… OK, imagine eating a Snikers…
1 a an almost parallel column or rectangle shape. b a broad-based pyramid or bot
1 a an almost parallel column or rectangle shape. b a broad-based pyramid or bottom heavy. c an inverted pyramid or top heavy. d an hour glass. e None of the above 2. coal is cons…
1 a) Which of the following consequences of a signaling molecule binding to its
1 a) Which of the following consequences of a signaling molecule binding to its receptor is NOT a short-term response? cAMP binding and protein activation ubiquitination of a targ…
1 a. John has a hemoglobin of 6.0 g/dL and his physician has sent a type and scr
1 a. John has a hemoglobin of 6.0 g/dL and his physician has sent a type and screen to the blood bank for processing and has also ordered 4 units of blood. Following processing Jo…
1 a?The enzyme lysozyme catalyzes the hydrolysis of glyosidic bonds of peptidogl
1 a?The enzyme lysozyme catalyzes the hydrolysis of glyosidic bonds of peptidoglycans, a molecule found in the cell wall of some bacteria. Consider the three-dimensional model o…
1 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcatc 61 tgactcctg
1 acatttgctt ctgacacaac tgtgttcact agcaacctca aacagacacc atggtgcatc 61 tgactcctga ggagaagtct gccgttactg ccctgtgggg caaggtgaac gtggatgaag 121 ttggtggtga ggccctgggc agg…
1 and 2 QUESTION 1 0 points Save Answer The novel weapon system associated with
1 and 2 QUESTION 1 0 points Save Answer The novel weapon system associated with the emergence of the early modern state was gunpowder artillery. These weapons were deployed prefer…
1 and 2 please 0 points Save Answer Which of the following is (are) an accurate
1 and 2 please 0 points Save Answer Which of the following is (are) an accurate statement about the first archaic states? O a Coercive systems were diverse, sometimes including un…
1 and 2, or 3 and 4, to initiate HR; 1, 2, 3, and 4 to resolve recombinant chrom
1 and 2, or 3 and 4, to initiate HR; 1, 2, 3, and 4 to resolve recombinant chromosomes 1 and 4, or 2 and 3, to initiate HR; 2 and 3 (two cuts each) to resolve recombinant chromoso…
1 and 6. Thanks Chapter 8: Cellular Reproduction: Cells from Cells Complete the
1 and 6. Thanks Chapter 8: Cellular Reproduction: Cells from Cells Complete the following table that compares mitosis with meiosis. Rounds of DNA replication Mitosis Meiosis Round…
1 atggcaactctaaaggatcagctgatttataatcttctaaaggaagaacagaccccccag 61 aataagattacagt
1 atggcaactctaaaggatcagctgatttataatcttctaaaggaagaacagaccccccag 61 aataagattacagttgttggggttggtgctgttggcatggcctgtgccatcagtatctta 121 atgaaggacttggcagatgaacttgctcttgttgatgtcatcgaagac…
1 ee th best anwers. Central Do t ae 2. Circle the best answer. DNARNA polymeras
1 ee th best anwers. Central Do t ae 2. Circle the best answer. DNARNA polymerase makes RNA 3. Circle the best answer. RNA is made during 4. Circle the best answer, Protein is mad…
1 important components of some enzymes are cofactors They are: a-organic compone
1 important components of some enzymes are cofactors They are: a-organic components b-metallic ions …
1 important components of some enzymes are cofactors Theyare: a-organic componen
1 important components of some enzymes are cofactors Theyare: a-organic components b-metallic ions c- active sites d-substrates E- ribozymes 2- The RNA molecules that carry the ge…
1 ml 1 ml 1 ml 1 ml 9 ml 9 ml 99 ml 9 ml 1 frm each tube, A, B, C, and D, was pl
1 ml 1 ml 1 ml 1 ml 9 ml 9 ml 99 ml 9 ml 1 frm each tube, A, B, C, and D, was plated onto each of 4 petri dishes. The number of colonies (CFUs) counted on each plate are as follow…
1 neurotransmitter of parasympathetic (cholinergic) nerves that stimulates choli
1 neurotransmitter of parasympathetic (cholinergic) nerves that stimulates choliner gic receptors 2. neurotransmitter of sympathetic nerves that stimulates the adrenergic receptor…
1 of 1 Reset Help of interest into encoding one of your lipids Rhodopseudomonas
1 of 1 Reset Help of interest into encoding one of your lipids Rhodopseudomonas bacterium You can introduce the are easy and perhaps cause it to produce the biofuel. Because these…
1 of 1 You are a scientist on board on a mission exploring undersea volcanic ven
1 of 1 You are a scientist on board on a mission exploring undersea volcanic vents around the Hawaian Islands. On your expedition ship you have a fully equipped laboratory where y…
1 of 1- 1.0 Points Question 23 of 29 A cross-sectional study finds that persons
1 of 1- 1.0 Points Question 23 of 29 A cross-sectional study finds that persons younger than 70 years of age have a higher prevalence of pneumonia than those older than age 70 . w…
1 of 49 Shown here is a nutrition facts label for 1 cup of whole cow\'s milk Whi
1 of 49 Shown here is a nutrition facts label for 1 cup of whole cow's milk Which of the following is most abundant by weight in 1 cup of whole milk? (1,000 mg 1 g) Nutrition Fact…
1 of 5 It is a misperception that GED recipients are unintelligent; as Tough (20
1 of 5 It is a misperception that GED recipients are unintelligent; as Tough (2012) noted, “according to their scores on achievement tests, GED recipients were every bit as smart …
1 p QUESTION 5 The remaining questions for the quiz will be based off this examp
1 p QUESTION 5 The remaining questions for the quiz will be based off this example. In order to answer everything work out the problem on paper first, then answer the following th…
1 p fic example of a symbiotic relationship? Be sure to include information that
1 p fic example of a symbiotic relationship? Be sure to include information that helps define the example as either mutualistic.commensal or parasitic Include question in the assi…
1 pc Your grandmother found out you\'re taking a course on human evolution and a
1 pc Your grandmother found out you're taking a course on human evolution and asks, 'did we evolve from chimpanzees? How do you answer her? OA. No; chimpanzees are more closely re…
1 points According to the central dogma of biology, DNA isinto mRNA, and then is
1 points According to the central dogma of biology, DNA isinto mRNA, and then is -into QUESTION 2 1 points Save Answer Fill in the following blank. The transcript is the product o…
1 points QUESTION 13 One of the reasons that natural selection can bring about e
1 points QUESTION 13 One of the reasons that natural selection can bring about evolution is because of variation in the genetic material of a population. What is the ultimate s…
1 points QUESTION 2 Several salespeople disagree with their team about how the n
1 points QUESTION 2 Several salespeople disagree with their team about how the new product introduction should be handled. This is an example of what level of conflict? intragroup…
1 points QUESTION 5 My protease has a globular structure with beta sheets, alpha
1 points QUESTION 5 My protease has a globular structure with beta sheets, alpha helix and many sharp turns It has a pocket where it binds amino acids and it has a flexible hinge …
1 points QUESTION 5 Uranium-238 is a radioactive element that will decay into le
1 points QUESTION 5 Uranium-238 is a radioactive element that will decay into lead-206. It has a half-life of 4.5 billion years, which means that after 4.5 billion years exactly o…
1 points QUESTION 9 The longer two populations are kept from interbreeding, the:
1 points QUESTION 9 The longer two populations are kept from interbreeding, the: greater the mutation rate will be. more recessive alleles will be expressed. greater the chance…
1 points Save Ans QUESTION 9 [Chapter 2, Lecture Based on the clicker pol from S
1 points Save Ans QUESTION 9 [Chapter 2, Lecture Based on the clicker pol from Spring 2015, how did the report of circumcision from students compare to the worldwide circumcision …
1 points Save Ans What rock type dominates the entire western part of New York S
1 points Save Ans What rock type dominates the entire western part of New York State (e.g. going towards Rochester) ? Igneous QUESTION 18 1 points Save Answer How old are the rock…
1 points Save Answer QUESTION 22 A drug\'s eiminasion hal ate reters to the leng
1 points Save Answer QUESTION 22 A drug's eiminasion hal ate reters to the lengm of tme at takes for the drug to be reduced to 50 per nug serin a be redc oh hi ogs hae the A Manju…
1 points Save Answer QUESTION 46 Consider a 10-carbon fatty acid. How many reduc
1 points Save Answer QUESTION 46 Consider a 10-carbon fatty acid. How many reduced coenzymes (NAHD and FADH2) molecules will be produced during the complete oxidation of this mole…
1 pts D Question 1 One\'s phenotype refers to C One of alternate states of a gen
1 pts D Question 1 One's phenotype refers to C One of alternate states of a gene O A specific pair of alleles inherited, one from each parent O The expression of a trait, or what …
1 pts Gluconeogenesis is a pathway that synthesizes glucose from simple molecule
1 pts Gluconeogenesis is a pathway that synthesizes glucose from simple molecules. Pick the BEST TRUE statement about the gluconeogenesis pathway and its regulation. O a. Glycolys…
1 pts Question 1 Which of the following contribute to the fact that the RNA proc
1 pts Question 1 Which of the following contribute to the fact that the RNA processing steps we discussed are specific for mRNA? Select all that apply. o Because mRNA is the only …
1 pts Question 1 is a method used by anthropologists to collect information by l
1 pts Question 1 is a method used by anthropologists to collect information by living with and participating in the daily lives of the people that they are studying. It is the bes…
1 pts Question 19 Which of the following statements regarding the complexity of
1 pts Question 19 Which of the following statements regarding the complexity of living organisms is FALSE o The body size of the largest living organisms has increased over evolut…
1 pts Question 5 To determine whether regulation of gene expression by siRNA was
1 pts Question 5 To determine whether regulation of gene expression by siRNA was a naturally phenomenon, researchers isolated RNA from a cell occurring and fractionated them by si…
1 pts What natural hazard is more common the Coastal South than other parts of N
1 pts What natural hazard is more common the Coastal South than other parts of North America and ses numerous deaths each year, particularly in Florida? 0 waterspouts O Sharks O F…
1 pts You buy raw milk and when you come home and taste it it\'s a bit sour. You
1 pts You buy raw milk and when you come home and taste it it's a bit sour. You want to know how many bacteria are in your bottle per 1 ml milk. You decide to perform a dilution s…
1 pts rains of the human papillomavirus (HPV) that cause cervical cancer express
1 pts rains of the human papillomavirus (HPV) that cause cervical cancer express many genes that the cervical cells that they infect do not. One of these viral genes encodes a pro…
1 t/f asexual reproduction is important to agricuture. 2. t/f offspring of asexu
1 t/f asexual reproduction is important to agricuture. 2. t/f offspring of asexual reproduction are genetically identical to the parent. 10. t/.f only simple plants reproduce asec…
Subject
Biology and Genetics
Use Browse or pick another subject.