Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 385 / 2033

9. In a hilly region, the best place to plant crops which are sensitive to low t
9. In a hilly region, the best place to plant crops which are sensitive to low temperatures is on the hillsides. 10. Hypothermia is most common in cold, dry weather. 11. Suppose t…
9. In a study, an undergraduate student discovered a new enzyme involved in the
9. In a study, an undergraduate student discovered a new enzyme involved in the metabolism of serotonin. This enzyme is made up of 6 subunits of the same protein. To characterize …
9. In an experiment (C-14) sugar studying photosynthesis, you provide a plant wi
9. In an experiment (C-14) sugar studying photosynthesis, you provide a plant with radioactive carbon ar olocide as a metabolic tracer. The C-14 is incorporated first into a four-…
9. In humans pattern baldness is a sex-influenced trait, whose degree of express
9. In humans pattern baldness is a sex-influenced trait, whose degree of expression is controlled by the sex of the individual, such that it is autosomal dominant in males while a…
9. In pea plants purple flowers are dominant to white flowers Two white flowered
9. In pea plants purple flowers are dominant to white flowers Two white flowered plants are crossed... What percentage of their offspring will have white flowers? 10. A white flow…
9. In the conversion of pyruvic acid, the types of reactions that take place are
9. In the conversion of pyruvic acid, the types of reactions that take place are A) hydrolysis and ATP formation B) decarboxylation and ATP formation C) hydrolysis and release of …
9. In the leaf mesophyll, the retreating hydration shell establishes a water pot
9. In the leaf mesophyll, the retreating hydration shell establishes a water potential gradient between the hydration shell and the interiors of leaf mesophyll cells. This water p…
9. In the presence of high intracellular concentrations of tryptophan, only shor
9. In the presence of high intracellular concentrations of tryptophan, only short transcripts of the trp operon are synthesized because of attenuation of transcription 5' to the s…
9. In the universal genetic codon table, there are three stop codons TAA, TAG an
9. In the universal genetic codon table, there are three stop codons TAA, TAG and TGA. (A) Suppose a piece of DNA has even frequencies of the four nucleotides ACGT (that is, the p…
9. Is HIV resistance evolving in Great Britain? Some people carry a mutation tha
9. Is HIV resistance evolving in Great Britain? Some people carry a mutation that makes them resistant to a particular strain of HIV. This form of HIV resistance is inherited as a…
9. Is it a cold front or warm front that is most closely associated with the fol
9. Is it a cold front or warm front that is most closely associated with the following progression of cloud types: Ci, Cs, As, St, Ns? Which would be seen first as the front appro…
9. It is estimated that in resource poor countries, approximately _complications
9. It is estimated that in resource poor countries, approximately _complications due to HIVIAIDS lack access to diagnostic tools and die as a result of treatment. (2 points) a 15%…
9. Lake Champlain, bordered by New York, Vermont, and Quebec, has a surface area
9. Lake Champlain, bordered by New York, Vermont, and Quebec, has a surface area of ,km^2 (squared). (a) if it freezes solid in the winter with an average thickness of 0.5m, how m…
9. M spectrophotometer easure the absorbance of each tube at 595 nm. The tubes f
9. M spectrophotometer easure the absorbance of each tube at 595 nm. The tubes fit directly into the sample holder of the Enter your raw data for the absorbance measurements of th…
9. Many health food stores carry enzyme preparations that are intended to be ing
9. Many health food stores carry enzyme preparations that are intended to be ingested orally (by mouth) to supplement existing enzymes in various organs like the liver, heart, and…
9. Many species of seabirds, including albatrosses, nest in colonies on islands.
9. Many species of seabirds, including albatrosses, nest in colonies on islands. Young raised in a colony return to that colony to breed. Some ecologists who study seabirds turn t…
9. Match each item in the left column with the single most appropriate item in t
9. Match each item in the left column with the single most appropriate item in the right column. Each number should be used only once a. auxotroph b. conjugation C. Hfr d. transdu…
9. Match the immunity concepts: - Inflammation - antibody secretion - phagocyte
9. Match the immunity concepts: - Inflammation - antibody secretion - phagocyte - immunological memory - vaccination - allergy a. nonspecific response b. nonprotective immune resp…
9. Members of the Animal Kingdom most likely evolved from an ancestor resembling
9. Members of the Animal Kingdom most likely evolved from an ancestor resembling A. a multicellular heterotrophic alga B. a multicellular heterotrophic fungus C. a colonial unicel…
9. Moon Phases: How well do you know the Moon phases? There are various types of
9. Moon Phases: How well do you know the Moon phases? There are various types of information that help you to identify a particular Moon phase. See how you do with the questions b…
9. Mutations in the IL2RG gene cause approximately 30% of severe combined immuno
9. Mutations in the IL2RG gene cause approximately 30% of severe combined immunodeficiency disorder cases (SCID). These mutations result in alterations to a protein component of c…
9. Nucleosomes are a. Ribosome-mRNA complexes b. Condensed chromosomes c. Barr b
9. Nucleosomes are a. Ribosome-mRNA complexes b. Condensed chromosomes c. Barr bodies d. Another term for centrioles e. DNA-histone complexes 10. Chromosome-level gene repression …
9. One of the \"primary\" reasons why the south-westem United States still recei
9. One of the "primary" reasons why the south-westem United States still receive a cheap and abundant supply of water from distant places to irrigate crops is ? a. it is the only …
9. Parasitic helminths have a highly developed A. digestive ysm td eng A B. nerv
9. Parasitic helminths have a highly developed A. digestive ysm td eng A B. nervous enhance host transmission. C. reprductive D. A. and B E. A and C s may contribute to autoimmuni…
9. Plant Jike photownthesis that releases oxygen occurs in cyanobacteria Gram po
9. Plant Jike photownthesis that releases oxygen occurs in cyanobacteria Gram positive bacteria Archaea d. Spirochaetes 10. According to e the endosymbiotic theory of the origin o…
9. Polymerase chain reaction (10 points) 5\" ATGTATTATTATTTTTTTGTTTTTTTTGCAATATA
9. Polymerase chain reaction (10 points) 5" ATGTATTATTATTTTTTTGTTTTTTTTGCAATATATGCTAATGGATTGCTAAGAAATA AAGATCCTAACATTTTTGCGAG TAGCAATGATGAGATCATAGAAAATGATAAAAGTATGAATACCTTTGTTATGT…
9. Pre-cleansing procedures called purva-karma inclu done to facilitate sweating
9. Pre-cleansing procedures called purva-karma inclu done to facilitate sweating and can be done by: A. sunbathing B. a steam bath C. a sweat box D. sitting in a tub of warm water…
9. Raschig rings were added to thein fractional distillation in order to West co
9. Raschig rings were added to thein fractional distillation in order to West condenser, prevent the liquid from bumping entered the condenser. plates condenser a. b. Claisen adap…
9. Refer to the figure below. Areas A and B are separated by a membrane that is
9. Refer to the figure below. Areas A and B are separated by a membrane that is permeable to a substance x. which set of conditions will result in the greatest rate of diffusion o…
9. Replacement of an A by a T in a region of the human gene for the B chain of h
9. Replacement of an A by a T in a region of the human gene for the B chain of hemoglobin is associated with sickle-cell anemia: Normal: 5-ATGGTGCACCTGACTCCTGAGGAGAAGTCT-3 Sickle …
9. Reset channel proteinschromatinchromosomesgenetic informationnuclear envelope
9. Reset channel proteinschromatinchromosomesgenetic informationnuclear envelopenuclear poresnucleolusnucleoplasmplasma membraneproteins The nucleus is the site within the cell th…
9. Reverse transcriptase (RT) is one of the essential enzymes encoded in the HIV
9. Reverse transcriptase (RT) is one of the essential enzymes encoded in the HIV genome. It is comprised of two domains with two distinct active sites that carry out three distinc…
9. Roots of modern Middle Eastern conflict. Readings: Stewart, 213–237; class le
9. Roots of modern Middle Eastern conflict. Readings: Stewart, 213–237; class lecture. a. What are some of the myths about Middle Eastern conflicts? To what extent do these myths …
9. Shanghai, China on Dec. 21st. Latitude______Sun Path_____Shadow Direction Sun
9. Shanghai, China on Dec. 21st. Latitude______Sun Path_____Shadow Direction Sun Angle at solar noon . Which of the above places (5-9) has the highest intensity of solar radiation…
9. Some microbial eukaryotes, such as Giardia , lack mitochondria. When this was
9.Some microbial eukaryotes, such as Giardia, lack mitochondria. When this was first discovered, it was thought that these lineages could represent the earliest diverging eukaryot…
9. Soon after people are infected with HIV, they start to make antibodies agains
9. Soon after people are infected with HIV, they start to make antibodies against the virus. Such individuals are said to have seroconverted. The graph below shows the percentage …
9. Strike-slip faults, like the San Andreas Fault, are not perfectly straight bu
9. Strike-slip faults, like the San Andreas Fault, are not perfectly straight but benod gradually back and forth. In some locations, the bends are oriented such that blocks on opp…
9. Study the diagram below, which represents the genotypes of two parents and on
9. Study the diagram below, which represents the genotypes of two parents and one gamete from each parent. TA Parents widows peak straight hairline melosis Gametes Offspring a) Wh…
9. Suppose you discovered a mutant eukaryotic organism whose glycolytic pathway
9. Suppose you discovered a mutant eukaryotic organism whose glycolytic pathway was shorter because of the presence of a new enzyme catalyzing the reaction below. Would shortening…
9. Suppose you have just purified an enzyme (lactase dehydrogenase - LDH) and wa
9. Suppose you have just purified an enzyme (lactase dehydrogenase - LDH) and want to check its activity. You know that in a pH 9 Tris buffer that LDH catalyzes the following reac…
9. Suppose you have just purified an enzyme (lactase dehydrogenase - LDH) and wa
9. Suppose you have just purified an enzyme (lactase dehydrogenase - LDH) and want to check its activity. You know that in a pH 9 Iris butler that LDH catalyzes the following reac…
9. Suppose you were asked to develop an experimental procedure to test if Carb C
9. Suppose you were asked to develop an experimental procedure to test if Carb Cutter is effective at preventing amylase from digesting starch. Here is a list of supplies and equi…
9. Test if the allele frequencies in our population are significantly different
9. Test if the allele frequencies in our population are significantly different from the world-wide frequencies using a chi-square test. Select one: a. chi-square = 131.44; 1 degr…
9. The Cambrian is a/an a. Era b. Epoch c. Period d. Eon 10. Both animals and fu
9. The Cambrian is a/an a. Era                  b. Epoch             c. Period                       d. Eon   10. Both animals and fungi are heterotrophic. What distinguishes anim…
9. The TPR (total physical response) to blood flow is greater than the resistanc
9. The TPR (total physical response) to blood flow is greater than the resistance to flow through any of the systemic organs. True or false? 10. Other factors constant equal, a de…
9. The United States has lost up to one-third of its original topsoil to erosion
9. The United States has lost up to one-third of its original topsoil to erosion, yet crop yields have not declined. This is because a. production has shifted to new regions with …
9. The cell theory a. explains how organisms have changed over time b. helps to
9. The cell theory a. explains how organisms have changed over time b. helps to identify the properties of life c. includes the idea that skin cells come from preexisting skin cel…
9. The chemical composition of olivine is (Mg, Fe SiO4. Which one of the followi
9. The chemical composition of olivine is (Mg, Fe SiO4. Which one of the following correctly de- scribes the chemical composition or crystal structure of olivine? (A) Silicon (Si)…
9. The evolution of insect wings is a “mystery” because a. many taxa have second
9. The evolution of insect wings is a “mystery” because a. many taxa have secondarily lost wings that function in flight. b. the ancestral state of the Hexapoda is the presence of…
9. The evolution of the vertebrate lung provides a classic example of how evolut
9. The evolution of the vertebrate lung provides a classic example of how evolution often builds upon pre-existing structures. The images below depict a swim-bladder organ present…