Browse C
Alphabetical listing with fast deep pagination.
81169 items • Page 340 / 1624
Can someone help writing JUnit for these methods: @Override // Songs ordered by
Can someone help writing JUnit for these methods: @Override // Songs ordered by artist in ascending order. public int compareTo(Song s){ int a = this.artist.compareTo(s.artist); i…
Can someone help, having trouble with this exercise. Thank you. Exercise #1 from
Can someone help, having trouble with this exercise. Thank you. Exercise #1 from Chapter 11, page 507. from Programming Logic and Design, Comprehensive, Joyce Farrell, 8th Edition…
Can someone help, supposed to use system.out.printf. Thank you 8. Write a method
Can someone help, supposed to use system.out.printf. Thank you 8. Write a method called smallestlargest that accepts a Scanner for the console as a parameter and asks the user to …
Can someone help. Im trying to figure out why the output file is giving me such
Can someone help. Im trying to figure out why the output file is giving me such a large number for the second column. This is a C program for a tridiagonal algoritm. Also im using…
Can someone help? I am having trouble with making the wording. \"pulling the dog
Can someone help? I am having trouble with making the wording. "pulling the dogsled should come after "SledDog :Husky". Here's the code.. DogApp.java package labPolymorphism; publ…
Can someone help? The Earth is not a perfect sphere; it\'s actually slightly obl
Can someone help? The Earth is not a perfect sphere; it's actually slightly oblate, meaning it bulges a bit around the equator. Given the following facts: The mass of the Earth is…
Can someone help? The figure shows a cross-member of a bridge lying in the xy pl
Can someone help? The figure shows a cross-member of a bridge lying in the xy plane of the page. The x- direction is horizontal and the y-direction is vertical. Gravity pulls down…
Can someone how me how to get started on this? I will need to parse a file that
Can someone how me how to get started on this? I will need to parse a file that contains records consisting of first name, last name, middle initial, and date of birth. Using Java…
Can someone implement the function and then TEST THAT FUNCTION IN A FULL PROGRAM
Can someone implement the function and then TEST THAT FUNCTION IN A FULL PROGRAM. the program must be able to run on visual studio. C language Exercise 8.6 In real Scrabble, there…
Can someone interpret this chart of regression? Question: Use the regress comman
Can someone interpret this chart of regression? Question: Use the regress command to run a regression of infant birth weight and maternal weight at last menstrual period. Interpre…
Can someone just answer multipl choice question 92 to 94 CGACTGACTCGACGGCCTAGCTA
Can someone just answer multipl choice question 92 to 94 CGACTGACTCGACGGCCTAGCTATAG. the primer is GCTGACTG. The number of DNA frargment resulting from the ddCTP tube is expected …
Can someone just finish this for me please. Tyrell Co. entered into the followin
Can someone just finish this for me please. Tyrell Co. entered into the following transactions involving short-term liabilities in 2015 and 2016. 2015 Apr. 20 Purchased $36,000 of…
Can someone just help me get started on the classsection of this? I know this on
Can someone just help me get started on the classsection of this? I know this one is a huge pain, but i will reallyappreciate it!!!! Manda :) Write a class named Adder that enable…
Can someone just help me with Questions 1 and 2?? Donald Donegood prepared a sol
Can someone just help me with Questions 1 and 2?? Donald Donegood prepared a solution of mandelic acid by dissolving 1.504 grams in water and diluting to a final volume of 100.0 m…
Can someone kindly explain why we use Fn and not Mg to determine x & y component
Can someone kindly explain why we use Fn and not Mg to determine x & y components and also what the Fapplied tells us? Any advice will be greatly appreciated! Problem 4.55 A s…
Can someone kindly explain: 1. What is the ratio of phenotypes from a monohybrid
Can someone kindly explain: 1. What is the ratio of phenotypes from a monohybrid 1a. What is the ratio of phenotypes from a dihybrid 1b. What is the ratio of geneotypes from a mon…
Can someone kindly help me with this assignment!? Instructions Download a copy o
Can someone kindly help me with this assignment!? Instructions Download a copy of SimpleSet.java. Implement this interface within the package csc143.data_strctures. Name the imple…
Can someone label the different peaks. Even the peaks that have been hand writte
Can someone label the different peaks. Even the peaks that have been hand written in red. A10 Darwin 95 90 85 3-74 ,07 24 c1.41 80 75 70 3500 3000 2500 1500 1000 500 Wavenumbers (…
Can someone let me know if I am correct please.... Help ASAP Question 1 Ion chan
Can someone let me know if I am correct please.... Help ASAP Question 1 Ion channels detect changes in membrane potential that trigger their opening and closing mediate the moveme…
Can someone list a similar project at least so I can try to do mine . math 120 M
Can someone list a similar project at least so I can try to do mine . math 120 MEC/Docs/Syllabus/MAT120.pdf Data Analysis Proiects Instructors must assign a minimum of 3 projects,…
Can someone list a similar project at least so I can try to do mine . math 120 M
Can someone list a similar project at least so I can try to do mine . math 120 MEC/Docs/Syllabus/MAT120.pdf Data Analysis Proiects Instructors must assign a minimum of 3 projects,…
Can someone look at my code and tell me whats wrong i use visual studio amd its
Can someone look at my code and tell me whats wrong i use visual studio amd its not doing what is supposed to #include<stdio.h> int main(){ char str[100]; int i = 0, j…
Can someone look at my code because my average doesn\'t work. Theaverage sometim
Can someone look at my code because my average doesn't work. Theaverage sometimes works but then prints random numbers. Thanks. #include <stdio.h> #include <stdlib.h> …
Can someone look at my paper and correct grammar, punctuation, help it flow bett
Can someone look at my paper and correct grammar, punctuation, help it flow better, and the flow the paper? To whom it may concern, I am writing this letter becaus…
Can someone look at my paper and correct grammar, punctuation, help it flow bett
Can someone look at my paper and correct grammar, punctuation, help it flow better, and the flow the paper? Also, can you highlight what you corrected or changed? To whom it may c…
Can someone look at this code and tell me what it does and add comments within t
Can someone look at this code and tell me what it does and add comments within the code to explain methods #include <iostream> #include <stdlib.h> #include <pthread…
Can someone look this over and tell me where I\'ve gone wrong, please? The probl
Can someone look this over and tell me where I've gone wrong, please? The problem to solve... John Barks owns Barks Computer Screens Inc. and wants to identify the supply and dema…
Can someone make a script off the info below? (The Account class) Design a class
Can someone make a script off the info below? (The Account class) Design a class named Account that contains: ? A private int data field named id for the account (default 0). ? A …
Can someone make some precise comment on this code and help me understand it: it
Can someone make some precise comment on this code and help me understand it: it is for minesweeper: public void mousePressed(MouseEvent evt) { int row, col; row = findR( evt.getY…
Can someone make sure if these answers I have are correct? Cause im not sure if
Can someone make sure if these answers I have are correct? Cause im not sure if they are because these were difficult questions! Thank you! Which of the following statements is fa…
Can someone make sure my answers are right? If not can you correct me? 1. For th
Can someone make sure my answers are right? If not can you correct me? 1. For this question, your group will be given the name of a Ferris Wheel somewhere in the world. Use this w…
Can someone make the pong game on MATLAB with a counter, timer, and score limit
Can someone make the pong game on MATLAB with a counter, timer, and score limit using these pictures. Also 1.One player controls the right paddle with the uparrow and downarrow ke…
Can someone make this a little clearer Actually, you can get the general case wi
Can someone make this a little clearer Actually, you can get the general case without calculus,too. Still assume both circles have radius 1, but allow the distancebetween their ce…
Can someone make this program in vector form #include #include
Can someone make this program in vector form #include <iostream> #include <string> using namespace std; int Menu(); void getName(string names[], int &count); int r…
Can someone makes this essay more cohesive and involve ways of knowing. Myth Bus
Can someone makes this essay more cohesive and involve ways of knowing. Myth Busters: Analyzing the Science of Memories The study of psychology is a very controversial and debatab…
Can someone me with this code for C++. I am using Code Blocks. The population of
Can someone me with this code for C++. I am using Code Blocks. The population of a town A is less than the population of town B. However, the population of town A is growing faste…
Can someone modify this code for me to do the following? Replace the structs in
Can someone modify this code for me to do the following? Replace the structs in your solution to the program with classes. Replace the array of class objects with a vector of clas…
Can someone modify this code to take in 6 inputs opposed to the 3 its taking in
Can someone modify this code to take in 6 inputs opposed to the 3 its taking in now? The output should be the product of all the six input arguments. You must use the stack (i.e.,…
Can someone modify this code to use properties instead of accessors and mutators
Can someone modify this code to use properties instead of accessors and mutators? Please do this for all three classes below. Class 1 Program.cs: using System; using System.Collec…
Can someone modify this code to work to complete a drunk knight tour.. The tour
Can someone modify this code to work to complete a drunk knight tour.. The tour shouldn't always go to every tile, and should print out the best tour thus far. If theres a way to …
Can someone olease help me with this, You are an attorney a client comes to you
Can someone olease help me with this, You are an attorney a client comes to you and advises you that her spouse applied for life insurance underwent the physical and died prior to…
Can someone over look my anwsers please and help me find how to solve for number
Can someone over look my anwsers please and help me find how to solve for number 4 please, thank you. Locations Measured Actual Distance Distance on (i mm or inches) Age Differenc…
Can someone paraphrase this article in own words? Thank you Medical Technology I
Can someone paraphrase this article in own words? Thank you Medical Technology Image Source: New York Med Tech Advancements in medical technology have allowed physicians to better…
Can someone paraphrase this article in own words? Thank you Medical Technology I
Can someone paraphrase this article in own words? Thank you Medical Technology Image Source: New York Med Tech Advancements in medical technology have allowed physicians to better…
Can someone paraphrase what written down ( inside red ) in one paragraph and in
Can someone paraphrase what written down ( inside red ) in one paragraph and in his own words .. Part 5 integrator op-amp: Channel 1 , v/div-0.5v Channel 2 , v/div= 1 v Figure 12:…
Can someone pease explain how my visual basic 2010 form should look like. I am h
Can someone pease explain how my visual basic 2010 form should look like. I am having a difficult time figure out how to set up the form. Create an application that calculates and…
Can someone plaese check and correct this problem if there are errors? Thanks So
Can someone plaese check and correct this problem if there are errors? Thanks Solve y"-5y'-6y=e^(-2t) where y’(0) = 1 and y(0) = -1 using LaPlace Transforms 1. Step 1: Rewrite the…
Can someone plaese clarify this question for me? I\'ve heardway too many variati
Can someone plaese clarify this question for me? I've heardway too many variations and now I'm confused. Explain the distinction between the cytosoland the cytoplasm of a cell? Te…
Can someone pleaae explain this calculation to me. I am so LOST. and I do not un
Can someone pleaae explain this calculation to me. I am so LOST. and I do not understand why it is wrong when I solved like this: Power = 2.0mJ/(16ns)=0.125 what is: 2*10^-3 / (16…
Can someone pleae explain how they were able to figure out the mRNA bands on the
Can someone pleae explain how they were able to figure out the mRNA bands on the gel diagram based off the 6 strains above. I'm really confused on how to approach this. Any break …