Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Cellular Dysfunction 1. Decreased pH in cytosol below the normal range 2. Decrea

ID: 269225 • Letter: C

Question

Cellular Dysfunction

1. Decreased pH in cytosol below the normal range

2. Decreased pH in mitochondria below the normal range

3. Increase in ATP

4. Increase in Hydrolysis

5. Decreasing levels of Glycogen and Triglycerides

6. Inherited Autosomal Recessive Mutation of hydrolytic enzymes (inherited at the organismal level, but impacts the single cell found in a tissue)

? Normal portion of gene: ATGCCCGCCCGCCGTTAGGCATCGCA

? Mutated portion of gene: ATGCCGCGCCCGCCGTTAGGCATGCGCA

7. Increased activity of mitogen-activated protein kinase(s)

8. Poor Ion transport

Questions: (Just need the answer to #3)

1. Identify and explain how the system of a single cell is supposed to function in a normal environment and is being affected by the items listed above. This means explaining how all aspects of the cell (inside and outside) may be impacted by these problems. The chain reaction of the system inside the cell. Some of them may be related and some of them might not, ultimately whether you can show the relationships demonstrates to me your understanding of the complexity and system of the cell.

a. Make sure to fully explain all of the items listed in the cellular dysfunction as well as all other related items in the system of a cell.

2. Identify and explain any causes that you believe may be associated with these cellular problems in one cell.

3. Explain how your team might be able to fix the one cell with these problems using cell biology and bioscience applications, such as Gene Therapy, developing new organelles, mitochondrial therapy, etc.

Explanation / Answer

3.

Hire Me For All Your Tutoring Needs
Integrity-first tutoring: clear explanations, guidance, and feedback.
Drop an Email at
drjack9650@gmail.com
Chat Now And Get Quote