Restart your subscription to keep accessing solutions. Your Chegg Study subscrip

Question

Restart your subscription to keep accessing solutions. Your Chegg Study subscription will expire on February 24, 2017.CONTINUE MY SUBSCRIPTION

home / study / science / biology / questions and answers / you have to amplify fixed size 3.5 kb product from ...

Your question has been answered

Let us know if you got a helpful answer. Rate this answer

Question: You have to amplify fixed size 3.5 kb product from...

Bookmark

You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:

Primer-F:    CGTTTCCCGCCTTCAGTTTAGC

Primer-R: CCCGATCTAGTAACATAGATGACACC

b.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.

Explanation / Answer

The genomic DNA is used as a template for the PCR amplification of 3.5kb product. The reactions for PCR are genomic DNA template - 50ng

Forward primer 10pm/uL

Reverse primer 10 pm/uL

MgCl2,dNTPS and 1Unit Taq DNA polymerase

The PCR condtions include denaturation, annealing and extension cycles. The annealing temperature need to standadised by checking a amplification of the desired PCR product at different temperature gradient for example temperature range of 50C/52C/54C/56C/58C/60C and higher can be checked

Initial Denaturation - 95 C for 5 min- 1 cycle

Denaturation - 95 C for 30 sec,Annealing temp. for 30 sec,Extension - 72C for 2 min - for 40 cycles

Extension 72 C for 10 min- 1 cycle

4C

The extension time is higher because the PCR product is 3500bp in length

Related Questions

Navigate

• Browse (All)
• Browse R
• Subjects

Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.