Restart your subscription to keep accessing solutions. Your Chegg Study subscrip
ID: 320459 • Letter: R
Question
Restart your subscription to keep accessing solutions. Your Chegg Study subscription will expire on February 24, 2017.CONTINUE MY SUBSCRIPTION
home / study / science / biology / questions and answers / you have to amplify fixed size 3.5 kb product from ...
Your question has been answered
Let us know if you got a helpful answer. Rate this answer
Question: You have to amplify fixed size 3.5 kb product from...
Bookmark
You have to amplify fixed size 3.5 kb product from isolated genomic DNA using forward and reverse primers below:
Primer-F: CGTTTCCCGCCTTCAGTTTAGC
Primer-R: CCCGATCTAGTAACATAGATGACACC
b.) Based on protocol we used in class for DreamTaq DNA polymerase design PCR cycling program for amplification of this fragment.
Explanation / Answer
The genomic DNA is used as a template for the PCR amplification of 3.5kb product. The reactions for PCR are genomic DNA template - 50ng
Forward primer 10pm/uL
Reverse primer 10 pm/uL
MgCl2,dNTPS and 1Unit Taq DNA polymerase
The PCR condtions include denaturation, annealing and extension cycles. The annealing temperature need to standadised by checking a amplification of the desired PCR product at different temperature gradient for example temperature range of 50C/52C/54C/56C/58C/60C and higher can be checked
Initial Denaturation - 95 C for 5 min- 1 cycle
Denaturation - 95 C for 30 sec,Annealing temp. for 30 sec,Extension - 72C for 2 min - for 40 cycles
Extension 72 C for 10 min- 1 cycle
4C
The extension time is higher because the PCR product is 3500bp in length
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.