Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 271 / 2033

29) One of the buffers that contribute to pH stability in human blood is carboni
29) One of the buffers that contribute to pH stability in human blood is carbonic acid (H2CO3). Carbonic acid is a weak acid that, when placed in an aqueous solution, dissociates …
29) The most important preventive measure for diphtheria is: a) Avoid infected p
29) The most important preventive measure for diphtheria is: a) Avoid infected persons b) Immunization with diphtheria toxoid e) Immunization with diphteria antitox in d) Antibiot…
29) The type of reproductive barrier that occurs when two species mate but produ
29) The type of reproductive barrier that occurs when two species mate but produce sterile hybrids is 29) referred to as?? B) a prezygotic barrier D) temporal isolation C) a postz…
29) What is the function of topoisomerase? A) relieving strain in the DNA ahead
29) What is the function of topoisomerase? A) relieving strain in the DNA ahead of the replication forlk B) elongating new DNA at a replication fork by adding nucleotides to the e…
29) is a task that requires the cooperation and effort of two or more people to
29) is a task that requires the cooperation and effort of two or more people to be completed successfully a. dissociation work b. subordinate goal c. functional work d. superordin…
29). The gray commissure of the spinal cord surrounds the central canal. True Fa
29). The gray commissure of the spinal cord surrounds the central canal. True False 30). The arbor vitae is found in the cerebrum. True False 31). Sympathetic tone is defined as c…
29, Components of the ribosomes are synthesised in which structure? (Where are t
29, Components of the ribosomes are synthesised in which structure? (Where are the rnbosomes madety A. nucleolus B. rough endoplasmic reticulum C. D, nucleoid 30. What organelle h…
29- True or False Most metal compounds are safe to use as antimiceobial agents 3
29- True or False Most metal compounds are safe to use as antimiceobial agents 30- Trie or False An instrument classified as eritical is an endoscope tube. 31- which of the follow…
29-32 Which is not a component of a nucleotide? A) PO_4- B) Nitrogenous base. C)
29-32 Which is not a component of a nucleotide? A) PO_4- B) Nitrogenous base. C) Ribose. D)Protein. Where does mitosis occur in fungi and some protists? A) In the mitosis occur in…
29-32 Which is not a component of a nucleotide? A) PO_4- B) Nitrogenous base. C)
29-32 Which is not a component of a nucleotide? A) PO_4- B) Nitrogenous base. C) Ribose. D)Protein. Where does mitosis occur in fungi and some protists? A) In the mitosis occur in…
29. (6 points) The following is a segment of DNA containing a portion of the 5\'
29. (6 points) The following is a segment of DNA containing a portion of the 5'UTR and the beginning of a gene. There are no introns. 3' GGGCATACTTCAGTCAAGAGACATAGATCCGTATG -5' 5 …
29. (6 points): You are a lead food scientist in a yogurt company and responsibl
29. (6 points): You are a lead food scientist in a yogurt company and responsible for developing a new Streptococcus thermophilus strain that is resistant to two types of phages, …
29. A cultured batch of human kidney cell has 5,000 copies of ALR mRNA/cell. You
29. A cultured batch of human kidney cell has 5,000 copies of ALR mRNA/cell. You injected some synthetic dsRNA with sequence homology with the ALR mRNA (average 2 copies/cell). Af…
29. A small, reproductively isolated religious sect called the Dunkers was estab
29. A small, reproductively isolated religious sect called the Dunkers was established by 27 families that came to the United States from Germany 200 years ago. The frequencies fo…
29. An earthquake with magnítude 8.0 releases about the energy of an earthquake
29. An earthquake with magnítude 8.0 releases about the energy of an earthquake with magnitude 4.0. a. twice d. ten thousand tim b. two hundred times c. four hundred times 0. What…
29. Cimeal edite s A. True B. false 30. Braided streams: A. consist of a series
29. Cimeal edite s A. True B. false 30. Braided streams: A. consist of a series of cut-banks and point bars B. only flow part of the year and are dry the rest of the year C. have …
29. Diploid cells of the fruit fly Drosophila have ten chromosomes. How many chr
29. Diploid cells of the fruit fly Drosophila have ten chromosomes. How many chromosomes does a Drosophila gamete have? a. One b. Two c. Five d. Ten e. Twenty 30. DNA carries gene…
29. ELISA is widely used as the initial screening test for diseases such as HIV,
29. ELISA is widely used as the initial screening test for diseases such as HIV, lupus, and Lyme disease. How would western blot be used in the diagnostic workflow? 30. Protein ma…
29. F2 generation A. Offspring resulting from the interbreeding of the hybrid Fl
29. F2 generation A. Offspring resulting from the interbreeding of the hybrid Fl generation B. The first filial or hybrid offspring in a C. A breeding experiment mating an individ…
29. Given a map view showing a circular vent region from which a pyroclastic eru
29. Given a map view showing a circular vent region from which a pyroclastic eruption occurred while a wind was blowing from the north. Find the correct contour map for ash thickn…
29. Humans are unable to digest a. proteins b. cellulose c. lipids d. both b. an
29. Humans are unable to digest a. proteins b. cellulose c. lipids d. both b. and c. are correct e. none of the above are correct 30. Waxes are "hydrophilic" molecules. a. True b.…
29. Identify each statement as being for glycolysis, acetyl CoA production, Citr
29. Identify each statement as being for glycolysis, acetyl CoA production, Citric Acid cycle or oxidative phosphorylation. a) Uses Oxygen we breathe in to make water and 32 ATP b…
29. If all the molecules of hemoglobin contained in RBCs were free in the plasma
29. If all the molecules of hemoglobin contained in RBCs were free in the plasma A. it would considerably increase blood oxygen carrying capacity. capillaries. B. it would facilit…
29. If the cell I look at under the mikroscope has ribosomes, DNA, cytosol(cytop
29. If the cell I look at under the mikroscope has ribosomes, DNA, cytosol(cytoplasm), and a nucleus what type of cel is a. Eukaryotic b. Prokaryotic 30. Which is TRUE about these…
29. In an average individual the liver glycogen is depleted during starvation in
29. In an average individual the liver glycogen is depleted during starvation in approximately A) 45-60 minutes. B) 4-6 hours C) 18-24 hours. D) 55-60 hours. E) S-7 days 30. Exces…
29. In noncyclic photosynthesis, (select all that apply) 30. A photosystem (sele
29. In noncyclic photosynthesis, (select all that apply) 30. A photosystem (select all that apply) 31. Steps of the Calvin Cycle include (select all that apply) 32. C4 photosynthe…
29. Mitosis occurs only in gametic cells a. True b. False c. They are both corre
29. Mitosis occurs only in gametic cells a. True b. False c. They are both correct d. None is correct Haploid cells have 2x23 chro mosomes while diploid cells have 1x23 chromosome…
29. Most of the fresh water on eart h is present in the form of a. ice caps and
29. Most of the fresh water on eart h is present in the form of a. ice caps and glaciers b. water in rivers c. water in lakes d. groundwater 30. Stri p mining for coal a. does not…
29. Oxybutynin (Ditropan) is prescribed for a client diagnosed with an overactiv
29. Oxybutynin (Ditropan) is prescribed for a client diagnosed with an overactive bladder (OAB). The client reports having experienced numerous adverse effects with the immediate-…
29. Oxygen in the earth\'s atmosphere originated from a. Plants photosythesis b.
29. Oxygen in the earth's atmosphere originated from a. Plants photosythesis b. Inorganic catalytic reactions on clays c. extraterrestrial meteorites d. Cyanobacteria photosynthes…
29. Sponges with the least filtering capacity (relative to their overall size) p
29. Sponges with the least filtering capacity (relative to their overall size) possess which body form? A. syconoid B. placoid C. leuconoid D. osculoid E. asconoid 30. Schistosomi…
29. Stephen Jay Gould (1989) and others have argued that the evolution of self-c
29. Stephen Jay Gould (1989) and others have argued that the evolution of self-conscious, intelligent species (i.e. humans) was historically contingent: it would not have occurred…
29. Teleostei include(2 answers). a a blenny (Andamia tetradactyla) [Percomorpha
29. Teleostei include(2 answers). a a blenny (Andamia tetradactyla) [Percomorphacea) that repasts feeds) on saxicolous algae b. Periopthalmodon schlosseri (Percomorphacea), which …
29. The Carbon Cycle is an important biochemical cycle on Earth. Describe the ba
29. The Carbon Cycle is an important biochemical cycle on Earth. Describe the basic steps of the Carbon Cycle, and how concentrations of atmospheric and terrestrial carbon can flu…
29. The central opening in the eye through which ight parises is the Pup el Conj
29. The central opening in the eye through which ight parises is the Pup el Conjunctiva a) Anterior chamber Posterior chamber 0. The ear ossides connect the a) Tympanic membrane t…
29. The ectoderm of th e embryo gives rise to the a. lining of the digestive tra
29. The ectoderm of th e embryo gives rise to the a. lining of the digestive tract b. blood vesselse. d. lungs 30. The yolk plug a. results from involution of endodermal cells b. …
29. The envelope of enveloped a. nucleic acid viruses contains predominantly b.
29. The envelope of enveloped a. nucleic acid viruses contains predominantly b. lysozyme .peptidoglycan predominantly obtained from the host cell upon exiting e. carbohydrates 30.…
29. The first codon in protein translation is called the a. stop codon b. start
29. The first codon in protein translation is called the a. stop codon b. start codon c. initiation sequence d. potential codon e. triplet starter 30. What is the complementary mR…
29. The organelles with are the c. Goglgi apparatus d, chloroplasts 5 10 15 20 2
29. The organelles with are the c. Goglgi apparatus d, chloroplasts 5 10 15 20 25 30 35 40 45 S ncresing ight inteniyTremperature o Graph A Graph B 0. Refer to the illustration ab…
29. The three domains proposed by Carl Woese are A) Bukarya, Rantae, and Bacteri
29. The three domains proposed by Carl Woese are A) Bukarya, Rantae, and Bacteria B) Protista, Plantae, and Eukarya. C Fungi, Protista, and Bacteria D) Bacteria, Archaea, and Euka…
29. Trisomy 21 means that a person has ____. two copies of chromosome 2 and one
29. Trisomy 21 means that a person has ____. two copies of chromosome 2 and one copy of chromosome 1 Two copies of chromosome 2 and one copy of chromosome 1 Three copies of chromo…
29. True or False: Equalization of the amount of expression of X-linked genes in
29. True or False: Equalization of the amount of expression of X-linked genes in males and females i accomplished via random X chromosome inactivation in females in ALL species. 3…
29. Unregulated cell growth has led to the formation of a tumor. In order to pro
29. Unregulated cell growth has led to the formation of a tumor. In order to progress, the tumor needs nutrients and oxygen. It obtains these by attracting new blood vessels to th…
29. Waves of muscular contractions that propel the contents ofthe dige tive trac
29. Waves of muscular contractions that propel the contents ofthe dige tive tract am called A) segmentations. B) pendular movements. C) peristalsis. D) churning movements. E) mast…
29. Waves of muscular contractions that propel the contents ofthe dige tive trac
29. Waves of muscular contractions that propel the contents ofthe dige tive tract am called A) segmentations. B) pendular movements. C) peristalsis. D) churning movements. E) mast…
29. What is the approximate orbital period of the Galilean moon that has the sma
29. What is the approximate orbital period of the Galilean moon that has the smallest orbit? (in units o B) 1.7 f Earth days) A)3.8 C) 0.4 D) 9.7 30. Which basic units were used t…
29. What is the estimated average seasonal temperature change in Miami, FL a. 25
29. What is the estimated average seasonal temperature change in Miami, FL a. 25°F b. 35°F c. 40°F d. 10°F 30. What is the estimated average seasonal temperature change in Regina,…
29. What is the phrase employed to describe the energy of position? a. potential
29. What is the phrase employed to describe the energy of position? a. potential energy b. dynamic energy c. kinetic energy d. both a. and b. are correct e. none of the above is c…
29. What is work that contributes directly to achieving a. implementation b. str
29. What is work that contributes directly to achieving a. implementation b. strategy c. planned work d. line work an organization's goals? 30. What is work that uses specialized …
29. What reduces IgMs effectiveness? a. Can not activate complement b. Binds too
29. What reduces IgMs effectiveness? a. Can not activate complement b. Binds too strongly to antigern c. Made late in immune response; infection already controlled d. Size (pentam…