Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Chemistry concepts and calculations

117302 questions • Page 2126 / 2347

You have been given a mixture of benzoic acid, phenol, aniline, and methoxybenze
You have been given a mixture of benzoic acid, phenol, aniline, and methoxybenzene in dichloromethane. How would you extract the benzoic acid? After accomplishing the goal of extr…
You have been given confiscated compounds from a makeshift laboratory and you ha
You have been given confiscated compounds from a makeshift laboratory and you have to characterizae these compounds. In an effort to characterize this compound, you performed the …
You have been given the task of purifying a 60 mL sample of toluene. In order to
You have been given the task of purifying a 60 mL sample of toluene. In order to develop our plan of action, you asl about the impurities likely to be present in the sample. You a…
You have been given the task of purifying a 60 mL sample of toluene. In order to
You have been given the task of purifying a 60 mL sample of toluene. In order to develop your plan of action, you ask about the impurities likely to be present in the sample. You …
You have been given the task of purifying a 60 mL sample of toluene. In order to
You have been given the task of purifying a 60 mL sample of toluene. In order to develop your plan of action, you ask about the impurities likely to be present in the sample. You …
You have been given the task of purifying a 60mL sample of toluene. In order to
You have been given the task of purifying a 60mL sample of toluene. In order to develop your plan of action, you ask about the impurities likely to be present in the sample. You a…
You have been given the task of synthesizing 2 alcohols for yourR&D boss at Alco
You have been given the task of synthesizing 2 alcohols for yourR&D boss at Alcohol SynthesizersAnonymous (sorry!). Listed below are the only reagents towhich you have access.…
You have been given the task of synthesizing 2 alcohols for yourR&D boss at Alco
You have been given the task of synthesizing 2 alcohols for yourR&D boss at Alcohol Synthesizers Anonymous (sorry!).Listed below are the only reagents to which you have access…
You have been given the task of synthesizing 2 alcohols for yourR&D boss at Alco
You have been given the task of synthesizing 2 alcohols for yourR&D boss at Alcohol Synthesizers Anonymous (sorry!).Listed below are the only reagents to which you have access…
You have been hired as the CIO of a large multinational Internet advertising com
You have been hired as the CIO of a large multinational Internet advertising company. The president of the company is entertaining a major new software development project to keep…
You have been hired by XYZ Firm as an information technology (IT) analyst who wi
You have been hired by XYZ Firm as an information technology (IT) analyst who will work closely with the new chief information officer (CIO) on a 5-week contract. The CIO was put …
You have been hired by a company that is working to generate fuel from bacteria
You have been hired by a company that is working to generate fuel from bacteria that consume organic waste products. The bacteria must be grown in a medium with a pH similar to th…
You have been hired by an insurance company to investigate claims filed by Reage
You have been hired by an insurance company to investigate claims filed by Reagents Unlimited, Inc. (a chemical company that claims there was a fire in their company offices and s…
You have been hired by an insurance company to investigate claims filed by Reage
You have been hired by an insurance company to investigate claims filed by Reagents Unlimited, Inc. (a chemical company that claims there was a fire in their company offices and s…
You have been hired fresh out of college by a geoengineering consulting firm, Ge
You have been hired fresh out of college by a geoengineering consulting firm, Geoengineering Real Solutions. You are put on a team evaluating ocean fertilization with iron as a wa…
You have been hired to check the technical correctness of an upcoming made-for-T
You have been hired to check the technical correctness of an upcoming made-for-TV murder mystery that takes place in space. In one scene, a brave astronaut is out on an emergency …
You have been hired to work on software that helps users catalog their board gam
You have been hired to work on software that helps users catalog their board game collections. This software will utilize a binary search when the user selects the search option. …
You have been hired to write an application by your employer, Crying Four Year O
You have been hired to write an application by your employer, Crying Four Year Olds Inc. Your company produces a miracle elixir that when given to a crying four year old (let’s sa…
You have been hired to write an application by your employer, Crying Four Year O
You have been hired to write an application by your employer, Crying Four Year Olds Inc. Your company produces a miracle elixir that when given to a crying four year old (let’s sa…
You have been recently hired as a computer technician at a local computer sales
You have been recently hired as a computer technician at a local computer sales and repair shop. The shop offers a variety of services that range from installing new applications …
You have been recently hired as a network security analyst for a small accountin
You have been recently hired as a network security analyst for a small accounting firm. The firm is realizing that they need help to secure their network and customer’s data. With…
You have been recently promoted to the position of a Network Administrator of a
You have been recently promoted to the position of a Network Administrator of a network which has 15 Windows Servers 2012 EE & 200 Windows 7 workstations. Your supervisor has …
You have been recently promoted to the position of a Network Administrator of a
You have been recently promoted to the position of a Network Administrator of a network which has 15 Windows Servers 2012 EE & 200 Windows 7 workstations.   Your company will …
You have been recently promoted to the position of a Network Administrator of a
You have been recently promoted to the position of a Network Administrator of a network which has 15 Windows Servers 2012 EE & 200 Windows 7 workstations.   Your company will …
You have been recently promoted to the position of a Network Administrator of a
You have been recently promoted to the position of a Network Administrator of a network which has 15 Windows Servers 2012 EE & 200 Windows 7 workstations.   Recently some of t…
You have been sent by the Environmental Protection Agency to measure SO emission
You have been sent by the Environmental Protection Agency to measure SO emissions from a small industrial power plant. You withdraw and analyze a gas sample from the boiler stack …
You have been sent by the Environmental Protection Agency to measure SO2 emissio
You have been sent by the Environmental Protection Agency to measure SO2 emissions from a small industrial power plant. You withdraw and analyze a gas sample from the boiler stack…
You have been sent to investigate for trace amounts of the iodide ion (I^-) in g
You have been sent to investigate for trace amounts of the iodide ion (I^-) in groundwater around the GGC campus. To perform your analysis, 1.00 L of a groundwater sample is first…
You have been studying for a long time in order to be prepared for the lab. You
You have been studying for a long time in order to be prepared for the lab. You also have a test in the lecture course. A dilemma arises. You ask yourself some deep questions: Do …
You have been tasked to design an operating System Kernel that will provide basi
You have been tasked to design an operating System Kernel that will provide basic system calls for the following compute Standard CPU with 32 bitregisters. Four of the registers h…
You have been working with a contractor and designer on your dream kitchen. Your
You have been working with a contractor and designer on your dream kitchen. Your designer brings in samples for your counter tops. You notice that all of the samples are labeled "…
You have before you two glasses of Amontillado wine - one made last year and one
You have before you two glasses of Amontillado wine - one made last year and one made many years ago. You have claimed to be an expert wine connoisseur (now that you are 21 years …
You have carried out five separate titrations to determine the concentration of
You have carried out five separate titrations to determine the concentration of a sodiurn hydroxide solution, and obtained the following values: 0.0285, 0.0290, 0.0282, 0.0306, 0.…
You have carried out radiometric dating analysis on four igneous rocks uncovered
You have carried out radiometric dating analysis on four igneous rocks uncovered at several sites that you have been exploring. From the % lead you determine in each case, what is…
You have conducted a synthesis reaction which yields a product that is soluble i
You have conducted a synthesis reaction which yields a product that is soluble in organic solvents. However, the reaction by-products include both an organic salt (KCL) and H2SO4 …
You have decided to take CHEM 156, and you are doing an enzyme assay in class. Y
You have decided to take CHEM 156, and you are doing an enzyme assay in class. You know that this enzyme obeys Michaelis-Menten kinetics, and you know the Km of the enzyme is 1.0 …
You have designed a centrifuge system to separate cells from a solution. A mixtu
You have designed a centrifuge system to separate cells from a solution. A mixture of water and cells enters the centrifuge system at a rate 1000 L/h and contains 500 mg cells/L. …
You have determined the concentration of formaldehyde vapor in the offices of th
You have determined the concentration of formaldehyde vapor in the offices of the science complex. which of the following statistical tests would you use to determine whether ther…
You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAG
You have determined the sequence of a cDNA clone to be: TATAAACTGGACAACCAGTTCGAGCTGGTGTTCGTGGTCGGTTTTCAGAAGATCCTAACGCTGACGTACGTAGACAAGTTGATAGATGATGTGCATCGGCTGTTTCGAGACAAGTA Since …
You have developed a model for the formation of micelles, based on expressions f
You have developed a model for the formation of micelles, based on expressions for the chemical potential mu(mono) of the free monomeric molecules in solution and the chemical pot…
You have discovered a new mammal and have studied the hemoglobin isolated from t
You have discovered a new mammal and have studied the hemoglobin isolated from the blood of this uncharacterized animal. A Hill plot of the O2 binding data for the hemoglobin yiel…
You have discovered a new mammal and have studied the hemoglobin isolated from t
You have discovered a new mammal and have studied the hemoglobin isolated from the blood of this uncharacterized animal. A Hill plot of the O2 binding data for the hemoglobin yiel…
You have discovered a new microbe that prefers to grow in the almost frozen wate
You have discovered a new microbe that prefers to grow in the almost frozen waternear Antarctica (1 degree C). You extract from this organism a protein (called Protein A) that per…
You have discovered a new microbe that prefers to grow in the almost water near
You have discovered a new microbe that prefers to grow in the almost water near Antarctica (1 degree C). You extract from this organism a protein (called Protein A) that performs …
You have discovered a novel protein that has a pI=5.5. To study the functional p
You have discovered a novel protein that has a pI=5.5. To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid c…
You have discovered a novel protein that has a pl = 5.5. To study the functional
You have discovered a novel protein that has a pl = 5.5. To study the functional properties of this new protein, your research group has made a mutant that contains two amino acid…
You have discovered an organism that has a fatty acid synthase system that makes
You have discovered an organism that has a fatty acid synthase system that makes arachidic acid (a 20 carbon fully saturated fatty acid) instead of palmitic acid as most cells do.…
You have discussed the results of Noorduim, ct al. This is a controlled experime
You have discussed the results of Noorduim, ct al. This is a controlled experiment designed to show the process of principle that a slight excess of one enantiomer can lead to com…
You have dissolved 2 g of a mixture of benzoic acid and naphthalene in 30 ml of
You have dissolved 2 g of a mixture of benzoic acid and naphthalene in 30 ml of diethyl ether and started the extraction procedure. Match the question with an appropriate answer f…
You have dissolved 2 g of a mixture of benzoic acid and naphthalene in 30 ml of
You have dissolved 2 g of a mixture of benzoic acid and naphthalene in 30 ml of diethyl ether and started the extraction procedure. Match the question with an appropriate answer f…