Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse A

Alphabetical listing with fast deep pagination.
167681 items • Page 240 / 3354

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
A DC voltage is hooked up to two very large parallel plates. The battery holds t
A DC voltage is hooked up to two very large parallel plates. The battery holds the plates at a constant potential difference B. The permitivity of the space between the plates is …
A DC voltage source provides a voltage V = 12.0V and is connected to a resistor
A DC voltage source provides a voltage V = 12.0V and is connected to a resistor of resistance B = 150 (omega) and an ideal inductor with inductance L, forming the circuit shown in…
A DC voltage source provides a voltage V = 12.0Vand is connected to a resistor o
A DC voltage source provides a voltage V = 12.0Vand is connected to a resistor of resistance R = 150? and an ideal inductor with inductance L, forming the circuit shown in the fig…
A DC voltage source supplies 100V to a transformer\'s primary coil, which has 50
A DC voltage source supplies 100V to a transformer's primary coil, which has 50 turns. If the secondary coil has 50 turns, what is the secondary voltage? (Please show your work. N…
A DC voltage source supplies 100V to a transformer\'s primary coil, which has 50
A DC voltage source supplies 100V to a transformer's primary coil, which has 50 turns. If the secondary coil has 50 turns, what is the secondary voltage? (Please show your work. N…
A DC-9 performs a manueber over a 65 second duration that allows for 25 seconds
A DC-9 performs a manueber over a 65 second duration that allows for 25 seconds of "weightlessness" during a central segment. A set of parametic equations describe the planes posi…
A DFT processor is to be used to estimate the frequency spectrum of a real signa
A DFT processor is to be used to estimate the frequency spectrum of a real signal. The system must be able to process any signal having frequencies up to 250 Hz. In addition, the …
A DFT processor is to be used to estimate the frequency spectrum of a real signa
A DFT processor is to be used to estimate the frequency spectrum of a real signal. The system must be able to process any signal having frequencies up to 250 Hz. In addition, the …
A DFT processor is to be used to estimate the frequency spectrum of a real signa
A DFT processor is to be used to estimate the frequency spectrum of a real signal. The system must be able to process any signal having frequencies up to 250 Hz. In addition, the …
A DFT processor is to be used to estimate the frequency spectrum of a real signa
A DFT processor is to be used to estimate the frequency spectrum of a real signal. The system must be able to process any signal having frequencies up to 250 Hz. In addition, the …
A DJ has 20 songs to choose from and can only play 7 in the next half hour. 1)Ho
A DJ has 20 songs to choose from and can only play 7 in the next half hour. 1)How many different combinations are possible if the Dj doesn't want to repeat songs? 2) A friend of t…
A DJ is playing an Armin van Buuren record on Turntable A at a typical 33.3 rpm,
A DJ is playing an Armin van Buuren record on Turntable A at a typical 33.3 rpm, while a Blank & Jones record rests motionless on Turntable B. At a given time, he turns on one…
A DJ is playing an Armin van Buuren record on Turntable A at a typical 33.3 rpm,
A DJ is playing an Armin van Buuren record on Turntable A at a typical 33.3 rpm, while a Blank & Jones record rests motionless on Turntable B. At a given time, he turns on one…
A DL test is carried out on a crude oil sample taken from an oil field in Alaska
A DL test is carried out on a crude oil sample taken from an oil field in Alaska. The sample, with a volume of 310 cc, is placed in a PVT cell at its bubble- point pressure of 301…
A DMA module is transferring characters to main memory from an external device t
A DMA module is transferring characters to main memory from an external device transmitting at 500,000 bits per second (bps). The processor can fetch instructions at the rate of 1…
A DMBA student stated, “A good friend once told me, ‘the train will move if you
A DMBA student stated, “A good friend once told me, ‘the train will move if you are on it or not.’” I replied, "In relationship to your points regarding prioritizing staying on sc…
A DNA binding protein recognizes a specific 8 nucleotide sequence in DNA. Assumi
A DNA binding protein recognizes a specific 8 nucleotide sequence in DNA. Assuming that the binding is perfectly specific, how many binding sites are expected to exist for it in h…
A DNA double helix is composed of two strands of complementary (not identical) D
A DNA double helix is composed of two strands of complementary (not identical) DNA. One strand, labeled as the template strand, serves and the template from which a complementary …
A DNA fragment was sequenced using dye-terminator sequencing. In this procedure,
A DNA fragment was sequenced using dye-terminator sequencing. In this procedure, ddATP was tagged with a green dye, ddCTP was tagged with a blue dye, ddGTP was tagged with a yello…
A DNA fragment was sequenced using dye-terminator sequencing. In this procedure,
A DNA fragment was sequenced using dye-terminator sequencing. In this procedure, ddATP was tagged with a green dye, ddCTP was tagged with a blue dye, ddGTP was tagged with a yello…
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosi
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosidase) genes are treated with EcoRI with the goal of making recombinant DNA molecules. The lacZ gene…
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosi
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosidase) genes are treated with EcoRI with the goal of making recombinant DNA molecules. The lacZ gene…
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosi
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosidase) genes are treated with EcoRI with the goal of making recombinant DNA molecules. The lacZ gene…
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosi
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosidase) genes are treated with EcoRI with the goal of making recombinant DNA molecules. The lacZ gene…
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosi
A DNA sample and a plasmid with the ampR and lacZ (for the enzyme beta-galactosidase) genes are treated with EcoRI with the goal of making recombinant DNA molecules. The lacZ gene…
A DNA sample and a plasmid with the amp^R and lacZ (for the enzyme beta-galactos
A DNA sample and a plasmid with the amp^R and lacZ (for the enzyme beta-galactosidase) genes are treated with Notl with the goal of making recombinant DNA molecules. The lacZ gene…
A DNA sequence composed of repeating identical sequences Jack and Jill are under
A DNA sequence composed of repeating identical sequences Jack and Jill are undergoing RFLP analysis. Chromosome 1 has been isolated and digested with restriction enzyme HaeIII. Wh…
A DNA sequence consists of a string with one of 4 bases (A, T, C, and G) at each
A DNA sequence consists of a string with one of 4 bases (A, T, C, and G) at each position in the string (e.g. ATACCAGGCT). You are studying the evolution of two species of Hawaiia…
A DNA sequence is a sequence of some combination of the characters A (adenine),
A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DN…
A DNA sequence is a sequence of some combination of the characters A (adenine),
A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DN…
A DNA sequence is a sequence of some combination of the characters A (adenine),
A DNA sequence is a sequence of some combination of the characters A (adenine), C (cytosine), G (guanine), and T (thymine) which correspond to the four nucleobases that make up DN…
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo aci
A DNA sequence that reads TAC CCC GAA will code for a protein with what ammo acid sequence? A. Met-Pro-Glu B. Tyr-Pro-Glu C. Tyr-Gly-Lcu D. Met-G I y-Leu E. Met-Pro-Lcu If the seq…
A DNA strand can be represented as a String of characters, where each character
A DNA strand can be represented as a String of characters, where each character represents one of four nucleotide molecules: Adenosine, Cytosine, Guanine, and Thymine. The DNA str…
A DNA strand has incorporated a base mismatch that has been missed by the proofr
A DNA strand has incorporated a base mismatch that has been missed by the proofreader in DNA Polymerase. How docs the cell identify the DNA strand with the correct base? It doesn'…
A DNA strand has the sequence 5’ A-C-A-G-T-A-A-A- 3’. Which of the followings if
   A DNA strand has the sequence 5’ A-C-A-G-T-A-A-A- 3’. Which of the followings if the real sequence? 3’ T-G-T-C-G-G-C-A-T-T-T 5’ 3’ A-C-A-G-C-C-G-T-A-A-A 5’ 3’ U-G-U-C-G-G-C-A-U…
A DNA strand has the sequence A-C-A-G-C-C-G-T-A. What would be the messenger RNA
A DNA strand has the sequence A-C-A-G-C-C-G-T-A. What would be the messenger RNA transcribed from it? (Points : 2)        A-C-A-G-C-C-G-T-A        A-C-A-G-C-C-G-U-A        T-G-T-C…
A DNA string (also called a DNA strand) is a sequence of the letters a,c,g,and t
A DNA string (also called a DNA strand) is a sequence of the letters a,c,g,and t in any order. For example, aacgtttgtaaccagaactgt is a DNA string of length 21. Each sequence of th…
A DNA template plus primer with the structure 3\'P - TGCGAATTAGCGACAT - P - 5\'
A DNA template plus primer with the structure 3'P - TGCGAATTAGCGACAT - P - 5' 5'-P -ATCGGTACGACGCTTAAC-OH-3' is placed in an in vitro DNA synthesis system, containing a mutant for…
A DNA test is conducted to see if the evidence can clear asuspect. From the susp
A DNA test is conducted to see if the evidence can clear asuspect. From the suspect's perspective we are testing                      H0:DNA is that of the suspect                …
A DNA- binding protein called a ___________ binds at a site in DNA called a ____
A DNA- binding protein called a ___________ binds at a site in DNA called a ____________. These proteins may include a _______ hormone bound to a receptor. This receptor includes …
A DNS server is any computer registered to join the Domain Name System. A DNS se
A DNS server is any computer registered to join the Domain Name System. A DNS server runs special-purpose networking software, features a public IP address, and contains a databas…
A DOH study concluded that by following 7 simple health rules,a man\'s life can
A DOH study concluded that by following 7 simple health rules,a man's life can be extended by 11 years on the average and awoman's life by 7 years. These 7 rules are: no smoking, …
A DOH study concluded that by following 7 simple health rules,a man\'s life can
A DOH study concluded that by following 7 simple health rules,a man's life can be extended by 11 years on the average and awoman's life by 7 years. These 7 rules are: no smoking, …
A DOT is performing a benefit-cost analysis of a new highway using an analysis p
A DOT is performing a benefit-cost analysis of a new highway using an analysis period of 40 years as part the required environmental impact assessment of the project. The section …
A DOT is performing a benefit-cost analysis of a new highway using an analysis p
A DOT is performing a benefit-cost analysis of a new highway using an analysis period of 40 years as part the required environmental impact assessment of the project. The section …
A DVD is a video recording consisting of a spiral track about 1.0 mu m wide with
A DVD is a video recording consisting of a spiral track about 1.0 mu m wide with digital information. The digital information consists of a series of pits that are read by a laser…
A DVD is rotating with an ever increasing speed. How do the angular velocity, an
A DVD is rotating with an ever increasing speed. How do the angular velocity, angular acceleration, tangential velocity, and tangential acceleration compare at points P and Q? Ang…
A DVD is rotating with an ever increasing speed. How do the angular velocity, an
A DVD is rotating with an ever increasing speed. How do the angular velocity, angular acceleration, tangential velocity, and tangential acceleration compare at points P and Q? A) …
A Daredevil wishes to bungee-jump from a hot-air balloon 65.0 m above a carnival
A Daredevil wishes to bungee-jump from a hot-air balloon 65.0 m above a carnival midway. He will use a piece of uniform elastic cord tied to a harness around his body to stop his …
A Data file which contains records to be read into the data structure. Record.ja
A Data file which contains records to be read into the data structure. Record.java: The “Record" class will be the objects stored in the value for each keyword in the tree. This c…