Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse G

Alphabetical listing with fast deep pagination.
13318 items • Page 88 / 267

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
Give reasons for 5 stars! Concern over the loss of local biodiversity has increa
Give reasons for 5 stars! Concern over the loss of local biodiversity has increased the urgency of understanding its consequences for ecosystem function in many habitats. Research…
Give reasons for 5 stars! Concern over the loss of local biodiversity has increa
Give reasons for 5 stars! Concern over the loss of local biodiversity has increased the urgency of understanding its consequences for ecosystem function in many habitats. Research…
Give reasons for 5 stars! Ecologists tested the effects that neighboring alpine
Give reasons for 5 stars! Ecologists tested the effects that neighboring alpine (mountain) plants had had on multiple target plant species at different elevations. They wanted to …
Give reasons for 5 stars! Ecologists tested the effects that neighboring alpine
Give reasons for 5 stars! Ecologists tested the effects that neighboring alpine (mountain) plants had had on multiple target plant species at different elevations. They wanted to …
Give reasons for 5 stars! Energy spent on reproduction constitutes an organism’s
Give reasons for 5 stars! Energy spent on reproduction constitutes an organism’s “reproductive effort”. The figure below shows the relationship between reproductive effort (number…
Give reasons for 5 stars! Energy spent on reproduction constitutes an organism’s
Give reasons for 5 stars! Energy spent on reproduction constitutes an organism’s “reproductive effort”. The figure below shows the relationship between reproductive effort (number…
Give reasons for 5 stars! The figure below represents the interaction web of fis
Give reasons for 5 stars! The figure below represents the interaction web of fish, insects, and plants in an ecosystem. Solid lines denote direct interactions, whereas dotted line…
Give reasons for 5 stars! To test how predicted increases in nitrogen deposition
Give reasons for 5 stars! To test how predicted increases in nitrogen deposition might affect species rich temperate grassland ecosystem, researchers set up the following experime…
Give reasons for your I. Decide if each of the following situations fits the bin
Give reasons for your I. Decide if each of the following situations fits the binomial setting. answer in each case. If x has a binomial distribution, state the values of n and p. …
Give reasons for your I. Decide if each of the following situations fits the bin
Give reasons for your I. Decide if each of the following situations fits the binomial setting. answer in each case. If x has a binomial distribution, state the values of n and p. …
Give reasons for your answer in 5(d) above: ....................................
Give reasons for your answer in 5(d) above: ........................................................................................................... An investors who pay higher…
Give recursive definitions of each of the following sequences: 2, 6, 18, 54, 1,
Give recursive definitions of each of the following sequences: 2, 6, 18, 54, 1, -2, 4, -8, 16 2, 3, -1, 4, -5, 9, -14, 2,1/4, 16, 1/156, 65536 Find the first five terms of the rec…
Give regular expressions for the following languages on the alphabet {a, b}. (a)
Give regular expressions for the following languages on the alphabet {a, b}. (a) the set of all strings with an even number of a’s (b) the set of strings in which all runs are of …
Give scenarios will shift demand in the market for the market for cable televisi
Give scenarios will shift demand in the market for the market for cable television in a particular city. Briefly answer the following questions for each scenario. (a) Which of the…
Give senarios will shift supply in the market for gas-powered automobiles. Brief
Give senarios will shift supply in the market for gas-powered automobiles. Briefly answer the following questions for each scenario. (a) Which of the supply shifter variables (SPE…
Give several decimal places If you choose decimals. All of the following are acc
Give several decimal places If you choose decimals. All of the following are acceptable formats for answers: A prisoner escapes from jail and randomly selects one of three roads l…
Give several examples of shared and non-shared environmental influences that imp
Give several examples of shared and non-shared environmental influences that impacted you and your siblings. Explain how those influences shaped your personality and your life in …
Give several pieces of evidence that RNA preceded proteins and DNA in living thi
Give several pieces of evidence that RNA preceded proteins and DNA in living things Do your answers to (1) mean that the first life was RNA-based, with RNA serving as both the cat…
Give several pieces of evidence that RNA preceded proteins and DNA in living thi
Give several pieces of evidence that RNA preceded proteins and DNA in living things. Do your answers to (1) mean that the first life was RNA-based, with RNA serving as both the ca…
Give several pieces of evidence that RNA preceded proteins and DNA in living thi
Give several pieces of evidence that RNA preceded proteins and DNA in living things Do your answers to (1) mean that the first life was RNA-based, with RNA serving as both the cat…
Give several pieces of evidence that RNA preceded proteins and DNA in living thi
Give several pieces of evidence that RNA preceded proteins and DNA in living things. Do your answers to (1) mean that the first life was RNA-based, with RNA serving as both the ca…
Give short and yet thorough answers to the following questions. 1. If you attemp
Give short and yet thorough answers to the following questions. 1. If you attempt to add a float, an int, and a byte, what will be the type of the result? Explain. 2. Explain the …
Give short answers to the following questions: (16) i. Who is an accountant? ii.
Give short answers to the following questions: (16) i. Who is an accountant? ii. Describe various roles and activities that accountants perform. iii. What type of duties does a co…
Give six different examples of how thin layer chromatography is used in organic
Give six different examples of how thin layer chromatography is used in organic chemistry How do you calculate the R, value for a compound? Increasing the solvent polarity will ha…
Give some detailed explanation and do it with caution. Please. Fill in multiple
Give some detailed explanation and do it with caution. Please. Fill in multiple blanks. A CPU has a 32 bit address bus and page size 1024. The CPU generates the address A 0x275081…
Give some examples of how you would automate your wireless security architecture
Give some examples of how you would automate your wireless security architecture. For instance, what policies would you develop for wireless access how could those policies be aut…
Give some more examples Objective: Automate removal of effluvium from a building
Give some more examples Objective: Automate removal of effluvium from a building, and do so without human contact after the effluvium has been transmitted from a living human body…
Give some practical uses of knowing variation. A few thoughts: You are traveling
Give some practical uses of knowing variation. A few thoughts: You are traveling to a job interview; what clothes do you need to pack for a trip? Doctors need to know distribution…
Give some typical values of Molecular Diffusivity in gases, liquids and solids A
Give some typical values of Molecular Diffusivity in gases, liquids and solids A vapour mixture of hydrocarbons A and B is being rectified by contact with a liquid mixture of the …
Give summary of: Do you think Clorox is a good parent company for Burt’s Bees? Y
Give summary of: Do you think Clorox is a good parent company for Burt’s Bees? Yes, Clorox and Burt Bees shared the same core values and vision which focus on operating the compan…
Give the 2 similarities and 3 differences between: a. Protozoan and Poriferans b
Give the 2 similarities and 3 differences between: a. Protozoan and Poriferans b. Hydrozoans and Scyphozoans c. Acoelomate and pseudocoelomate d. Anthozoan and Hydrozoan e. Turbel…
Give the 95% Confidence inte Give a co nclusf ion for the confidence interval te
Give the 95% Confidence inte Give a co nclusf ion for the confidence interval test is Test of 2 Proportions ional courtesy, physiclans have traditionally provided health care free…
Give the ADT for a rectangleData, The data include, length and width of rectangl
Give the ADT for a rectangleData, The data include, length and width of rectangle. Your class must include at least the following functions: print - displays length, width, area, …
Give the Big O notation for the following function. public static void notationF
Give the Big O notation for the following function. public static void notationFunction(int arr[], int length) { System.out.println(“ This function is sweetâ€); for(int i = 0;i&…
Give the Big-O notation that best describes the following functions. (By best, I
Give the Big-O notation that best describes the following functions. (By best, I mean simplest and lowest bound using Big-O notation, for n large.) (a) 2n + 31 (b) 3n + (6n log2 n…
Give the Big-Oh for the running time of each code fragment. a. double power( dou
Give the Big-Oh for the running time of each code fragment. a. double power( double x, int n ) { double result = 1.0; for( int i = 0; i < n; i++ ) result *= x; return result; }…
Give the CPT codes for each scenario with their modifiers (hints are provided 2.
Give the CPT codes for each scenario with their modifiers (hints are provided 2. Digital nerve block was applied to numb the top of the right great toe and the left great toe. Blu…
Give the CPT codes for each scenario with their modifiers (hints are provided 2.
Give the CPT codes for each scenario with their modifiers (hints are provided 2. Digital nerve block was applied to numb the top of the right great toe and the left great toe. Blu…
Give the IUPAC and common names (if any) for each of the following amides: *Part
Give the IUPAC and common names (if any) for each of the following amides: *Parts A, B, and C. *Answer in terms of how Mastering Chemistry would want the answers. Course Home xyMa…
Give the IUPAC name for each of the following compounds. Note: do not forget to
Give the IUPAC name for each of the following compounds. Note: do not forget to use commas to separate locantnumbers from each other and to use hyphens to separate locantnumbers f…
Give the IUPAC name for the following compound. A. (Z)-2, 3, 6-trimethyl-2-hepte
Give the IUPAC name for the following compound. A. (Z)-2, 3, 6-trimethyl-2-heptene B. (Z)-2, 3, 6-trimethyl-3-heptene C. (E)-2, 3, 6-trimethyl-3-heptene D. (E)-2, 3, 6-trimethyl-2…
Give the IUPAC name for the following structure: 3-chloro-6-methylcyclohexanol 2
Give the IUPAC name for the following structure: 3-chloro-6-methylcyclohexanol 2-methyl-5-chlorocyclohexanol 1 -chloro-4-methylcyclohexanol 5-chloro-2-methylcyclohexanol 2-methyl-…
Give the MAJOR product of the following E2 reaction. Select the true statement r
Give the MAJOR product of the following E2 reaction. Select the true statement regarding the following carbocation intermediate a It can undergo a 1,2 -hydride shift to form a mor…
Give the Michaelis-Menten equation and define each term in it. Does this equatio
Give the Michaelis-Menten equation and define each term in it. Does this equation apply to all enzymes? If not, to which kind does it not apply? What is a zymogen (proenzyme)? Exp…
Give the Python program that creates the patterns as shown below. Your program s
Give the Python program that creates the patterns as shown below. Your program should be able to let the user specify the type of polygon at run time. Note: in turtle graphics, if…
Give the SQL command and the resulting table that was generated. a) List the nam
Give the SQL command and the resulting table that was generated. a) List the names of all students applying to a major related to biology. b) Find the number of students applying …
Give the advantage of linked lists over the packed array structure. and the disa
Give the advantage of linked lists over the packed array structure. and the disadvantage For a singly linked list, indicate which of the below operations are fast (not proportiona…
Give the amino acid sequence predicted by the following nucleotide sequence of a
Give the amino acid sequence predicted by the following nucleotide sequence of an RNA molecule. (Hint – look for the first start codon.) 5’ – CCAUGCAGCGACCGUGGGAAGGUCUUA – 3’ Ques…
Give the amino acid sequence predicted by the following nucleotide sequence of a
Give the amino acid sequence predicted by the following nucleotide sequence of an RNA molecule. (Hint – look for the first start codon.) 5’ – CCAUGCAGCGACCGUGGGAAGGUCUUA – 3’ Ques…
Give the amino acid sequence predicted by the following nucleotide sequence of a
Give the amino acid sequence predicted by the following nucleotide sequence of an RNA molecule. (Hint – look for the first start codon.) 5’ – CCAUGCAGCGACCGUGGGAAGGUCUUA – 3’ *Que…