What kinds or chemical bonds mediate base pairing In nucleic acids? Which DNA se
ID: 216441 • Letter: W
Question
What kinds or chemical bonds mediate base pairing In nucleic acids? Which DNA sequences are complementary to 5'- CATGGACTA-3'? (more than one correct answer) Which of the following sequences will not anneal to 5'- CCATAGGGACACCCAATCATTTACGTGACCCGAT-3'? How do cells know what sequence of nucleotides to string together when copying the genetic material of a cell that needs to divide? A pair of deoxiriboneuclotides weighs 1.08x1021 grams. Suppose that you have 10,000 cells with 3x1015 base pairs in their DNA. How many grams of DNA do you expect to extract from them? When you go ahead and extract the nuclear DNA from those 10,000 cells, it actually weighs significantly more than expected. Why? Which of the following are a major component of chromatin? (more than one correct answer) Which of the following statements best describes heterochromatin?Explanation / Answer
Base pairing in nucleic acid is made by the Hydrogen bond. The strands in nucleic acids are held in precise register by a regular base-pairing between the two strands: A is paired with T through two hydrogen bonds; G is paired with C through three hydrogen bonds.
The Complimentary DNA sequence
3’ GTACCTGAT5’
Any sequence which is not complimentary to the given sequence will not be able to anneal this sequence, OR if, any sequence containing high percentage of GC content will not be able to anneal OR if the annealing temperature is higher then it won’t be able to anneal, if the secondary structure is produce by the sequence then it wont be able to anneal because presence of the primer secondary structure produced by the intermolecular or intramolecular interactions will not be able to anneal the sequence. OR if the primer self-dimer is formed by intermolecular interactions between the two (same sense) primers, where the primer is homologous to itself then it wont be able to anneal the following sequence.
5’ CCATAGGGACACCCAATCATTTACGTGACCCGAT 3’
Heterochromatin is defined as chromosome segments that failed to decondense at the end of telophase, but which remained condensed throughout interphase, and which appeared as condensed segments at the following prophase, that is, it showed positive heteropyknosis. There is more than one class of heterochromatin. Constittuive heterochromatin, containing few genes and formed principally of repetitive sequences located in large regions coincidents with centromeres and telomeres.
Facultative heterochromatin, composed of transcriptionally active regions that can adopt the structural and functional characteristic of heterochromatin, such as the inactive X chromosome od mammals
Nucleic acid and Histone Proteins are the major component of the chromatin. Chromatin is the complex combination of DNA and proteins that makes up chromosomes. It is found inside the nuclei of eukaryotic cells. Chromatin is divided into heterochromatin (condensed) and euchromatin (extended) forms. The major proteins of chromatin are the eight (H2A H2B, H3 and H4) histones small proteins containing a high proportion of basic amino acids (arginine and lysine) that facilitate binding to the negatively charged DNA molecule.
The nucleotides that make up the new strand are paired with partner nucleotides in the template strand; because of their molecular structures, A and T nucleotides always pair with one another, and C and G nucleotides always pair with one another. This phenomenon is known as complementary base pairing, and it results in the production of two complementary strands of DNA.Base pairing ensures that the sequence of nucleotides in the existing template strand is exactly matched to a complementary sequence in the new strand, also known as the anti-sequence of the template strand. Later, when the new strand is itself copied, its complementary strand will contain the same sequence as the original template strand. Thus, as a result of complementary base pairing, the replication process proceeds as a series of sequence and anti-sequence copying that preserves the coding of the original DNA.
We will expect 3.24x10-6 gram of DNA from the 10000 cells containing 3x105 base pairs in their DNA
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.