Why does Mutation 4 express less levels than Mutation 3? Transcription start sit
ID: 252976 • Letter: W
Question
Why does Mutation 4 express less levels than Mutation 3?
Transcription start site 528 -35 region -10 region Consensus sequence__ TTGACA ?????? Wild-type Lac promoter GGCIITACACTITATGCTICCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTITACACITIATG IICCGGCTCGTATGTIGTGTGGAATT Mutant 2 GGCITTACACIITATGCITCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCITTACACTITATG TICCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTIGACACIITATG IICCGGCTCGTATAATGTGTGGAATT (b) g?a B-Galactosidase activity o è promoter Mutant 1 Mutant 2 Mutant 3 Mutant 4 2 promoterExplanation / Answer
If we observe the sequence of mutant 3 and 4, in the -35 region, mutant 3 has TTTACA sequence and mutant 4 has TTGACA sequence.
The expression of the protein is dependent on the rate of transcription. The melting of DNA begins in the -35 region and for smooth melting, the presence of A-T rich region is essential. Since A-T base pair has two hydrogen bonds, the time required to break this bond is less and hence, the expression will be higher.
In the given problem, mutant 3 has TTTACA sequence and mutant 4 has TTGACA sequence. The replacement of one T by G in mutant 4 has reduced the expression of this strain. The base pair G-C has three hydrogen bonds and thus the time required to break these bonds is also high. Hence, the expression in mutant 4 is less compared to the mutant 3.
Related Questions
drjack9650@gmail.com
Navigate
Integrity-first tutoring: explanations and feedback only — we do not complete graded work. Learn more.