Biology and Genetics
101624 questions • Page 1750 / 2033
Which of the following must be considered when developing policy related to clim
Which of the following must be considered when developing policy related to climate change? Principles of how the climate system operates How humans interact with climate Value ju…
Which of the following must be the order of the genes on the bacterial chromosom
Which of the following must be the order of the genes on the bacterial chromosomal circle? (A is shown at both ends to represent circularty. Assume that the Hfr picks up all inter…
Which of the following mutational changes would be predicted to harm an organism
Which of the following mutational changes would be predicted to harm an organism? Explain your answers. A. Insertion of a single nucleotide near the end of the coding sequence. B.…
Which of the following mutations could account for a cell line that is dividing
Which of the following mutations could account for a cell line that is dividing more rapidly than expected? A Ras-GAP mutation that causes enhanced activity A Ras-GEF mutation tha…
Which of the following mutations is most likely to have the greatest impact on t
Which of the following mutations is most likely to have the greatest impact on the phenotype of a human? a. Substitution in a non-protein coding region b. Insertion/Deletion of a …
Which of the following natural hazards produced by volcanoes is the most dangero
Which of the following natural hazards produced by volcanoes is the most dangerous to normal people living near the erupting volcano? A. A’a lava flows B. ash fall C. pyroclastic …
Which of the following objects has a surface that least resembles that of mercur
Which of the following objects has a surface that least resembles that of mercury venus The moon Mars Callisto What can be side regarding Mercury's surface temperature It is the b…
Which of the following observation(s) is/are most consistent with the origin of
Which of the following observation(s) is/are most consistent with the origin of mitochondria? A. Mitochondria RNA polymerases and ribosomes more closely resemble those found in eu…
Which of the following observations are not consistent with the idea that a dise
Which of the following observations are not consistent with the idea that a disease is caused, at least in part, by genes? Select one: a. The disease tends to develop at a charact…
Which of the following observations is supporting evidence that all populations
Which of the following observations is supporting evidence that all populations are linked by descent with modification? living animals all conduct transcription the same way foss…
Which of the following occurred first? a) the Milky Way b) the big Bang c) Earth
Which of the following occurred first? a) the Milky Way b) the big Bang c) Earth d) The Sun e) A nebula 2. Which of the following is essential in order for GPS to function? a) A G…
Which of the following occurs as the ribosome shifts down the mRNA by a distance
Which of the following occurs as the ribosome shifts down the mRNA by a distance of three nucleotides? a. The tRNA that was in the P site moves into the E site. b. The tRNA that w…
Which of the following occurs by an active transport process? Transport of Na^+
Which of the following occurs by an active transport process? Transport of Na^+ from a region of higher concentration to a region of lower concentration through a channel Simple d…
Which of the following occurs during days 15-28 of the menstrual cycle? prolifer
Which of the following occurs during days 15-28 of the menstrual cycle? proliferative phase ovulation menstruation secretory phase Which of the following occurs during an erection…
Which of the following occurs during the acquisition and assembly of viral envel
Which of the following occurs during the acquisition and assembly of viral envelopes? enveloped viruses surround themselves with plasma membrane synthesized by the virus during th…
Which of the following occurs in an angiosperm ovule? A) The egg nucleus is usua
Which of the following occurs in an angiosperm ovule? A) The egg nucleus is usually diploid. B) An antheridium forms from the megasporophyte. C) The fusion nucleus develops into t…
Which of the following occurs in prokaryotes but not in eukaryotes? a. post-tran
Which of the following occurs in prokaryotes but not in eukaryotes? a. post-transcriptional splicing b. exchange of nucleosomes c. translation in the absence of a ribosome d. gene…
Which of the following occurs with disruptive selection a. Natural selection fav
Which of the following occurs with disruptive selection a. Natural selection favors phenotypes of one extreme, resulting in a population mean shift over several generations b. Nat…
Which of the following options correctly lists the structures in the kidney in t
Which of the following options correctly lists the structures in the kidney in the order in which fluid flows through them? proximal tubule, Bowman's capsule, loop of Henle, dista…
Which of the following options is correct with respect to the characteristics of
Which of the following options is correct with respect to the characteristics of the CO2 (carbon dioxide) ? The concentration of CO2 in the atmosphere is increasing due to the ext…
Which of the following options lists the correct sequence of the appearance of t
Which of the following options lists the correct sequence of the appearance of the four major groups of plants in the fossils record, from most ancestral to most recent? seedless …
Which of the following orders of events occurs routinely during cytokine signali
Which of the following orders of events occurs routinely during cytokine signaling? (1 point) O Cytokine receptor >receptor dimerization > Serine/threonine (S/T-phosphorylat…
Which of the following organelles utilizes signal peptides to target newly synth
Which of the following organelles utilizes signal peptides to target newly synthesized proteins? ?.) Lysosome b.) Cytosol c) Chloroplast d.) Endoplasmic Reticulum e.) Golgi Appara…
Which of the following organic groups does hemoglobin belong to? A. Carbohydrate
Which of the following organic groups does hemoglobin belong to? A. Carbohydrate B. Protein C. Lipid D. Nucleic acid E. Vitamin Covalent bonds form when A. Molecules become ionize…
Which of the following organisms are prokaryotes? bacteria and fungi archaea and
Which of the following organisms are prokaryotes? bacteria and fungi archaea and fungi protozoa and animals bacteria and archaea viruses and prions Which of the following defines …
Which of the following organisms exhibits cephalization? a. snail b. sea anemone
Which of the following organisms exhibits cephalization? a. snail b. sea anemone c. sea star d. sponge e. Trichoplax The most successful of the invertebrate phyla with respect to …
Which of the following organisms has existed on earth for the longest time? Stro
Which of the following organisms has existed on earth for the longest time? Stromatolite-producing prokaryotes An oak tree Cyanobacteria A Protist Sperm or eggs in humans always _…
Which of the following organisms is NOT ultimately dependent on the sun as a sou
Which of the following organisms is NOT ultimately dependent on the sun as a source of energy? A. a night-blooming flower is pollinated by night-flying bats B. an underground eart…
Which of the following organisms is a chemoautotroph? O Escherichia col Sulfolob
Which of the following organisms is a chemoautotroph? O Escherichia col Sulfolobus solfataricus Haloferax volcanii Rhodospinillum rubrum QUESTION 2 What is the source of electrons…
Which of the following organisms is gram-negative? Staphylococcus aureus Escheri
Which of the following organisms is gram-negative? Staphylococcus aureus Escherichia coli Bacillus cereus None of the above Why is it recommended that Gram staining be performed o…
Which of the following organisms would be most likely to accumulate toxins due t
Which of the following organisms would be most likely to accumulate toxins due to biological magnification? Males of different species of the fruit fly that live in the same parts…
Which of the following organisms would be most likely to accumulate toxins due t
Which of the following organisms would be most likely to accumulate toxins due to biological magnification? Males of different species of the fruit fly that live in the same parts…
Which of the following organisms would you expect to have the shortest intestina
Which of the following organisms would you expect to have the shortest intestinal system? a. A very large carnivorous mammal that swallows its prey whole after killing it b. A sma…
Which of the following organs belong(s) to more than one organ system? kidney ur
Which of the following organs belong(s) to more than one organ system? kidney ureter pituitary gland larynx esophagus Which following organ systems is correctly matched with one o…
Which of the following organs is not part of the immune system The liver The spl
Which of the following organs is not part of the immune system The liver The spleen The bone marrow The thymus When the body affected by a virus. the virus produces DNA/genes that…
Which of the following organs is not part of the lower respiratory system? oroph
Which of the following organs is not part of the lower respiratory system? oropharynx trachea alveoli larynx bronchi Large airborne particles are filtered by hairs in the nasal ve…
Which of the following organs is retroperitoneal? pancreas ascending colon duode
Which of the following organs is retroperitoneal? pancreas ascending colon duodenum descending colon All of the choices are correct. Which of the following attaches the liver to t…
Which of the following organs/tissues receive their PSNS innervation from the Va
Which of the following organs/tissues receive their PSNS innervation from the Vagus nerve (CN X)? 1. Heart (SA & AV nodes) 2. Urinary bladder 3. Gall Bladder 4. Gastric pits i…
Which of the following organs/tissues receive their PSNS innervation from the Va
Which of the following organs/tissues receive their PSNS innervation from the Vagus nerve (CN X)? 1. Heart (SA & AV nodes) 2. Urinary bladder 3. Gall Bladder 4. Gastric pits i…
Which of the following pair of coordinates correspond to Seoul, South Korea? Sel
Which of the following pair of coordinates correspond to Seoul, South Korea? Select one: a. +43* 35', +39* 43' b. +34* 03', -118* 14' c. +37* 31', +127* 01’ d. +37* 46', +122* 25'…
Which of the following pair of enzymes are NOT examples of isozymes Enzyme G bin
Which of the following pair of enzymes are NOT examples of isozymes Enzyme G binds to glyceraldehyde with a Km of 0.1mM and Enzyme P binds to acetaldehyde with a Km of 0.1mM Enzym…
Which of the following pair of primers could be used to PCR amplify a fragment o
Which of the following pair of primers could be used to PCR amplify a fragment of the following DNA sequence? 5'GGAGCGGGGACAGGGCGCAGGGCATCAGCAGCCACCAGCAGGACCTGGGAAATAGGGATTCTTCTGC…
Which of the following pairs are listed in correct chronological order? the evol
Which of the following pairs are listed in correct chronological order? the evolution of photosynthetic organisms, then the evolution of multicellular plants the evolution of huma…
Which of the following pairs is NOT the result of a geneduplication? a. -and -ch
Which of the following pairs is NOT the result of a geneduplication? a. -and -chains of hemoglobin b. Chymotrypsin and subtilisin c. Any pair of paralogous proteins (paralogs) In …
Which of the following pairs is mismatched? A. dehydration reaction - water is a
Which of the following pairs is mismatched? A. dehydration reaction - water is a product of the reaction B. hydrolysis - water is used in decomposition reaction C. decomposition r…
Which of the following pairs is mismatched? A. neuroectoderm - nervous sustem B.
Which of the following pairs is mismatched? A. neuroectoderm - nervous sustem B. endodem - bone C. mesoderm - muscle D. ectoderm - skin E. neural crest cells - peripheral nervous …
Which of the following pairs of cancer hallmarks would be most directly eliminat
Which of the following pairs of cancer hallmarks would be most directly eliminated if you could restore p53 function (e.g., with a chaperone therapy) in tumor cells? A. “Replicati…
Which of the following pairs of events changes species diversity globally? (Poin
Which of the following pairs of events changes species diversity globally? (Points : 2) Immigration and emigration Speciation and extinction Speciation and im…
Which of the following pairs of structures are ANALOGOUS? (At least one pair mee
Which of the following pairs of structures are ANALOGOUS? (At least one pair meets the definition of analogous, but there may be more than one pair.) Explain your reasoning. FOR F…
Which of the following pairs of systems and neurotransmitters is/are correctly m
Which of the following pairs of systems and neurotransmitters is/are correctly matched? The left half of a person’s spinal cord has been severed at the level of the shoulders. Whi…
Subject
Biology and Genetics
Use Browse or pick another subject.