Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 202 / 2033

13. The genetic code is universal. What does this mean? A. There is only one cod
13. The genetic code is universal. What does this mean? A. There is only one codon for each amino acid. B. All scientists agree on the translation of the code. C. All living thing…
13. The heads of the Gemini twins (Castor and Pollux) will rise at midnight arou
13. The heads of the Gemini twins (Castor and Pollux) will rise at midnight around the start of which month? 14. At the start of which month can Hercules be found directly overhea…
13. The nurse is assessing a patient\'s skin during an office visit. What is the
13. The nurse is assessing a patient's skin during an office visit. What is the best technique to use to best assess the patient's skin temperature? Use the: a. fingertips because…
13. The ocean floor is deepest in which of the following? OA. rift valleys B. th
13. The ocean floor is deepest in which of the following? OA. rift valleys B. the abyssal plain C. submarine canyons D. oceanic trenches 14. Which is true regarding earthquake and…
13. The path of a _______ is associated with the updraft of the supercell. a) ha
13. The path of a _______ is associated with the updraft of the supercell. a) hailstreak b) hailswath c) both a hailstreak and a hailswath d) neither a hailstreak nor a hailswath …
13. The process of sporangium formation and endospore maturation requires 8-8 ho
13. The process of sporangium formation and endospore maturation requires 8-8 hours. What is most eey to result if the temperature of the environment was raised to 100 C about 2 h…
13. The sleep/wake cycle is influenced by the A. basal nuclei. B. reticular form
13. The sleep/wake cycle is influenced by the A. basal nuclei. B. reticular formation. C. vermis. D. thalamic nuclei. E. cerebellum. 14. The stalk that connects the hypothalamus t…
13. To help resolve problems of global structural violence all but which one of
13. To help resolve problems of global structural violence all but which one of the following values and cultural motivations would be needed? a. a worldview that sees humanity as…
13. Treatments for depression can include; a. Evaluation by PCP, Psychiatrist or
13. Treatments for depression can include; a. Evaluation by PCP, Psychiatrist or Psychologist b. Medication therapy d. All of the above types of approaches to therapy including; 1…
13. True or False: The change in energy for any chemical ren can be positive or
13. True or False: The change in energy for any chemical ren can be positive or negative 14. Which of these represents the energy carrying molecule found in all cells? ATP c. Phop…
13. Two different female Drosophila were isolated, each heterozy- gous for the a
13. Two different female Drosophila were isolated, each heterozy- gous for the autosomally linked genes b (black body), d (dachs tarsus), and c(curved wings). These genes are in t…
13. Two lights that have different wavelengths and intensities may look the same
13. Two lights that have different wavelengths and intensities may look the same (match), A color match between two lights occurs when - for each cone- the response to one light e…
13. Understand and be able to explain the purpose and processes of photosynthesi
13. Understand and be able to explain the purpose and processes of photosynthesis to the extent explained in lecture. Recognize the overall equation for this process. Know what th…
13. Using the Heart Rate Reserve Method, calculate the target heart rate zone fo
13.     Using the Heart Rate Reserve Method, calculate the target heart rate zone for the Tom: Tom: Age 20; Resting Heart Rate 60; Desired Target Heart Rate Zone: 70% to 85% of Ma…
13. Very large substances can ____________ the cell by endocytosis. During this
13. Very large substances can ____________ the cell by endocytosis. During this process, the plasma membrane surrounds the substance and then fused with the ____________ of the ce…
13. Viruses usually initiate infection by first interacting with receptors on th
13. Viruses usually initiate infection by first interacting with receptors on the surface of cells. Which of the following statements is most accurate about cellular receptors for…
13. Wh en replication of the E.C structure of the dinucleotide? replication of t
13. Wh en replication of the E.C structure of the dinucleotide? replication of the E. coli genome begins, after the first phosphodiester linkage is made, what is the o OO o OO HO-…
13. Wh en replication of the E.C structure of the dinucleotide? replication of t
13. Wh en replication of the E.C structure of the dinucleotide? replication of the E. coli genome begins, after the first phosphodiester linkage is made, what is the o OO o OO HO-…
13. What acts as hydrogen carrier in photosynthesis? a. ADP b. NAD d. NADP e FAD
13. What acts as hydrogen carrier in photosynthesis? a. ADP b. NAD d. NADP e FAD 14. Where do the light reactions take place? a. grana of the chloroplast b. matrix of the mitochon…
13. What did the results of most studies of the effects of environmental regulat
13. What did the results of most studies of the effects of environmental regulation on U.S. businesses show? a. environmental regulation discouraged the efficient use of resources…
13. What happens to autoreactive cells that escape the thymus? A. They attack se
13. What happens to autoreactive cells that escape the thymus? A. They attack self tissues. B. They can be rendered anergic. C.They negatively regulate other autoreactive cells. D…
13. What is the mode of locomotion of the Ciliophora? Which class of Protozoa ar
13. What is the mode of locomotion of the Ciliophora? Which class of Protozoa are incapable of movement? 13. What is the mode of locomotion of the Ciliophora? Which class of proto…
13. What is the mode of locomotion of the Ciliophora? Which class of protozoa ar
13. What is the mode of locomotion of the Ciliophora? Which class of protozoa are incapable of movement? 14. List the characteristics of algae. How do they differ from plants? Wha…
13. What is the mode of locomotion of the Ciliophora? Which class of protozoa ar
13. What is the mode of locomotion of the Ciliophora? Which class of protozoa are incapable of movement? 14. List the characteristics of algae. How do they differ from plants? Wha…
13. What is the mode of locomotion of the Ciliophora? Which class of protozoa ar
13. What is the mode of locomotion of the Ciliophora? Which class of protozoa are incapable of movement? 14. List the characteristics of algae. How do they differ from plants? Wha…
13. What magma type is continental and oceanic crust made of? 14. What magma pro
13. What magma type is continental and oceanic crust made of? 14. What magma properties influence volcanic eruptive style? 15. In what tectonic setting are explosive volcanoes fou…
13. What of the following is ordered from LARGEST to SMALLEST? a. mitochondrion,
13. What of the following is ordered from LARGEST to SMALLEST? a. mitochondrion, hemoglobin, virus, glucose, water molecule b. virus, mitochondrion, hemoglobin, glucose, water mol…
13. What type of faults in the next diagram are the \"Henrys Fork\" and \"Uinta\
13. What type of faults in the next diagram are the "Henrys Fork" and "Uinta" Faults? a. Thrust b. Reverse c. Normal d. Strike-slip North bend in section South Wyoming Utah Bear M…
13. When an object such as a spoon or straw is seenin a glass of water it looks
13. When an object such as a spoon or straw is seenin a glass of water it looks broken. This is because. . .: * the light passing through different materials at aslant is refracte…
13. When considering the evolution and diversification of life on earth, a genop
13. When considering the evolution and diversification of life on earth, a genoppe reproduction gives an (number of chromosomes) combined with organism the greatest flexibility, o…
13. When mice feel pain on their bodies, they lick that part of their body. Rese
13. When mice feel pain on their bodies, they lick that part of their body. Researchers injected bark scorpion venom into the hind paws of the common house mouse and the southern …
13. When multiple cytokines have the same effect on the same cell, by definition
13. When multiple cytokines have the same effect on the same cell, by definition they have: A) pleiotropy B) redundancy C) synergism D) antagonism 14. Which of the following cytok…
13. Which enzyme would you use to cut out a piece of DNA for molecular cloning?
13. Which enzyme would you use to cut out a piece of DNA for molecular cloning? DNA ligase RNA polymerase DNA polymerase restriction enzyme 14. Which of the following is a circula…
13. Which of the following is (are) a final prod a. Pyruvate b. Lactate. c. Etha
13. Which of the following is (are) a final prod a. Pyruvate b. Lactate. c. Ethanol and CO e. b and c. 14- Which of the following is (are) a final product(s) of acrobic respiratio…
13. Which of the following is (are) a final product(s) of fernmentation? a. Pyru
13. Which of the following is (are) a final product(s) of fernmentation? a. Pyruvate. b. Lactate. c. Ethanol and CO e. b and c. 14- Which of the following is (are) a final product…
13. Which of the following is (are) involved in post-translationa ation of eukar
13. Which of the following is (are) involved in post-translationa ation of eukaryotic gene expression? a. Altenative splicing. b. Enhancers d. Phosphorylation. e Transposons 14. W…
13. Which of the following sequences contain a six-nucleotide inverted repeat? (
13. Which of the following sequences contain a six-nucleotide inverted repeat? (a) GTCACGCGACGATACGGTCACG (b) GTCACGACTAGCCTAGTCGCTG (c) GTCACGACTAGCCATCAGCCTG (d) GTCACGACTAGCCCG…
13. Which of the following sequences contain a six-nucleotide inverted repeat? (
13. Which of the following sequences contain a six-nucleotide inverted repeat? (a) GTCACGCGACGATACGGTCACG (b) GTCACGACTAGCCTAGTCGCTG (c) GTCACGACTAGCCATCAGCCTG (d) GTCACGACTAGCCCG…
13. Which of the following sequences contain a six-nucleotide inverted repeat? A
13. Which of the following sequences contain a six-nucleotide inverted repeat? A. GTCACGCGACGATACGGTCACG B. GTCACGACTAGCCTAGTCGCTG C. GTCACGACTAGCCATCAGCCTG D. GTCACGACTAGCCCGACTA…
13. Which of the following statements is NOT true? a) in a eukaryotic mRNA, the
13. Which of the following statements is NOT true? a) in a eukaryotic mRNA, the poly-A tail promotes degradation of the molecules b) the longer the lifetime of an mRNA, the more p…
13. Which of the following types of transport occur across the a. glucose unipor
13. Which of the following types of transport occur across the a. glucose uniport b. O2 and CO2 passive diffusion c. aquaporin water transport d. CI- bicarbonate ion antiport e. A…
13. Which of the following would form an enolate ion on treas Ci, Cu.cu cusca.c
13. Which of the following would form an enolate ion on treas Ci, Cu.cu cusca.c CH CH a. A b. B ?.? d. D All of these except C e. 14. Which of the following does not represent a s…
13. Which of these statements is NOT true about DNA? a. it is the genetic materi
13. Which of these statements is NOT true about DNA? a. it is the genetic material of the cel b. it forms a double helix c. it contains the sugar ribose d. the paired nitrogen bas…
13. Which statement about phospholipids is incorrect a) Because their phosphate
13. Which statement about phospholipids is incorrect a) Because their phosphate groups repel each 9. Which of the fellowing statements about starch is a) Starch is the primary for…
13. Which statement below best characterizes the thermohaline circulation model?
13. Which statement below best characterizes the thermohaline circulation model? a. Cold fresh water from the poles flows on the surface to the equator b. Salty water at the equat…
13. Which statement is false? For hurricanes to develop: (a) The surface layer o
13. Which statement is false? For hurricanes to develop: (a) The surface layer of warm water in the ocean must be deep, at least 200 ft or more. (b) The winds in the atmosphere mu…
13. Which statement is true about cellular respiration? A) You cannot obtain ene
13. Which statement is true about cellular respiration? A) You cannot obtain energy (ATP) from fat as the energy expenditure is too much B) You cannot obtain energy (ATP) from pro…
13. Which statement is true about cellular respiration? You cannot obtain energy
13. Which statement is true about cellular respiration? You cannot obtain energy (ATP) from protein because of the energy expenditure You can obtain energy from both proteins and …
13. Why do we look at carbon and nitrogen ratios for composting? What other elem
13. Why do we look at carbon and nitrogen ratios for composting? What other elements might be important and again, why? 14. Well-managed compost piles are aerated to prevent bad s…
13. Would you expect X-linked recessive disorders to be more common in males or
13. Would you expect X-linked recessive disorders to be more common in males or females? Why? 14. Would you expect X-linked dominant disorders to be more common in males or female…