Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Biology and Genetics

101624 questions • Page 258 / 2033

22. Reset ATP NADH breathing ciliated flagellated movement Cilia and flagella ar
22. Reset ATP NADH breathing ciliated flagellated movement Cilia and flagella are both involved in  ____________ . The cells that line the respiratory tract are  ____________ , al…
22. Select the description of a motor end plate. a. the end of the axon of a neu
22. Select the description of a motor end plate. a. the end of the axon of a neuron at a junction with a muscle cell b. the plasma membrane of a skin cell at a synapse with a neur…
22. Some viruses can cause cancer. protective protein coat around the virus is c
22. Some viruses can cause cancer. protective protein coat around the virus is called a capsid. 24. Viruses cause AlDS, the flu, chicken pox, the common cold, and food poisoning S…
22. The American alligator is a(n) ____ because it plays a number of important r
22. The American alligator is a(n) ____ because it plays a number of important roles in the ecosystems where it is found in the southeastern United States.? a. ?endemic species b.…
22. The Burgess Shale formation has been a valuable source of a large number of
22. The Burgess Shale formation has been a valuable source of a large number of dinosaur fossils 23. The remains of dinosaurs cannot be used as index fossils. 24. Illustrations of…
22. The Theorist that stated that language is innate or inborn is True and False
22. The Theorist that stated that language is innate or inborn is True and False (I point each) 1. Most physical disorders or diseases, which fall in to the biosocial domain, also…
22. The acid in the stomach is HCl. The Cl- of the HCl originates from the extra
22. The acid in the stomach is HCl. The Cl- of the HCl originates from the extracellular fluid, and it is transported across the epithelium of the stomach by a process known as tr…
22. The blending-inheritance hypothesis proposed that the genetic material from
22. The blending-inheritance hypothesis proposed that the genetic material from parents is unavoidably and irreversibly mixed in the offspring. As a result, offspring and later de…
22. The counter-current exchange mechanism observed in the loop of Henle results
22. The counter-current exchange mechanism observed in the loop of Henle results in a high efficiency of removing water from the descending loop because: a. the water can be so ra…
22. The disorderthat is characterized by abnormal body image, fear of obesity an
22. The disorderthat is characterized by abnormal body image, fear of obesity andprolonged refusal to eat is called ___. (Points : 1)        23. A complexcarbohydrate that is a ch…
22. The following enzyme catalyzed reaction occurs through a nucleophilic substi
22. The following enzyme catalyzed reaction occurs through a nucleophilic substitution reaction (This is the reaction catalyzed by DNA polymerase). For this reaction, identify eac…
22. The graph to the right shows the rates of a chemical reaction and the effect
22. The graph to the right shows the rates of a chemical reaction and the effects of inhibition. Remember that [S] is concentration of substrate. A. What is Vmax? (1 pt) B. Predic…
22. The light dependent, that is, light-capturing reactions of photosynthesis pr
22. The light dependent, that is, light-capturing reactions of photosynthesis produce 23. The Calvin cycle, that is, the light-independent or dark reactions of photosynthesis 24. …
22. The main function of cellulose, a. to store genetic information. b. as a sto
22. The main function of cellulose, a. to store genetic information. b. as a storage compo c. as a storage compound for energy in animal cells. d. as a component of biological mem…
22. The organelle in plant cells that contains pigments & water 23. An organism
22. The organelle in plant cells that contains pigments & water 23. An organism that makes its own food, like plants 24. An organism that must obtain eterorophy its food, like…
22. The pyruvate dehydrogenase complex provides a transition between glycolysis
22. The pyruvate dehydrogenase complex provides a transition between glycolysis and the citric acid cycle. Which co-factors are considered stoichiometric and which are considered …
22. The resting membrane potential of a neuron =-73 mV. ECA+-+120 mV. The extrac
22. The resting membrane potential of a neuron =-73 mV. ECA+-+120 mV. The extracellular concentration of calcium = 2 mM. The cytoplasmic concentration of calcium at the resting me…
22. The smallest vessels of the arterial system are the: a. arterioles b. capill
22. The smallest vessels of the arterial system are the: a. arterioles b. capillaries c. venules d. arteries 23. The difference between the systolic and diastolic pressure is the:…
22. The temperature (T) in the ideal gas laws equation PV = nRT is in Celsius. T
22. The temperature (T) in the ideal gas laws equation PV = nRT is in Celsius. True , or False 23. One mole of volume of 22 4 liter at standard conditions (O"C and 1 atmosphere) a…
22. This coastal zone is usually dry and unvegetated. a. offshore zone b. backsh
22. This coastal zone is usually dry and unvegetated. a. offshore zone b. backshore zone c. foreshore zone do 23. Mesa and Scarp topography is most closely associated with: a. vul…
22. Two black guinea pigs were mated and over several years produced 29 black an
22. Two black guinea pigs were mated and over several years produced 29 black and 9 white offspring. Explain these results, giving the genotypes of parents and progeny.    b. How …
22. W hy is the error rate (incorporation of the wrong amino acid) of translatio
22. W hy is the error rate (incorporation of the wrong amino acid) of translation low? A. Specificity of base pairing between codons and anticodons. B. Specific binding of aminoac…
22. What is the difference between pollination fertilization? 23. Be able to des
22. What is the difference between pollination fertilization? 23. Be able to describe the gymnosperm life cycle (you will not have to diagram it, but you should be prepared for qu…
22. When chloroplasts are continuously illuminated with a weak white light, the
22. When chloroplasts are continuously illuminated with a weak white light, the intensity of fluorescence from the antenna chlorophylls is quite weak, with only about 2% of the ab…
22. Where on the enzyme does the inhibitor bind? 23. Are there any requirements
22. Where on the enzyme does the inhibitor bind? 23. Are there any requirements of the enzyme in order for the inhibitor to bind? 24. Does the Vmax for the enzyme change in the pr…
22. Which correctly describes the evolutionary origin and adaptive radiation of
22. Which correctly describes the evolutionary origin and adaptive radiation of molluses? A Molluscs originated in freshwater and invaded both terrestrial and marine environments …
22. Which correctly describes the evolutionary origin and adaptive radiation of
22. Which correctly describes the evolutionary origin and adaptive radiation of molnments uscs origin Molluscso ated in freshwater and invaded both terrestrial and marine oiginate…
22. Which of the following does not influence climate change? a. b. c. d. Winds
22. Which of the following does not influence climate change? a. b. c. d. Winds Clouds Albedo None of these, they all influence climate change. 23. Which of the following is a gre…
22. Which of the following individuals is acting to create a free-rider problem?
22. Which of the following individuals is acting to create a free-rider problem? a. By reliably reciprocating a cooperative behavior, all individuals in the population increase th…
22. Which of the following most clearly demonstrates PATTERN and not PROCESS in
22. Which of the following most clearly demonstrates PATTERN and not PROCESS in evolutionary biology? A new mutation arises in a mouse population increases melanin (dark fur pigme…
22. Why might that type of boundary produce more strong earthquakes than the bou
22. Why might that type of boundary produce more strong earthquakes than the boundary along the coast of California? 23. Notice that divergent boundaries appear to have the fewest…
22. You are using bacteriophages to map the genome of a new bacteria species and
22. You are using bacteriophages to map the genome of a new bacteria species and find the locations of three toxin-production genes (R, Y, and G). You grow phages in a strain of t…
22. You have identified an enzyme from a thermophilic bacterium that lives in ho
22. You have identified an enzyme from a thermophilic bacterium that lives in hot springs which converts glucose into a com pattern baldness. You will be rich! However, when you e…
22. are organisms that sustain themselves without consuming organic molecules fr
22. are organisms that sustain themselves without consuming organic molecules from other organisms. 23. During 3 turns of the Calvin cycle, (a)_molecule(s) of CO2 are added molecu…
22. ionization for 1.2 Msolution of hydeofuoric acid given that the Ka for (18 p
22. ionization for 1.2 Msolution of hydeofuoric acid given that the Ka for (18 points) is 1AN ph pOn HF P1 TH'1 Percent order kinetics with a rate 23. The decomposition of an inse…
22. which statement is an accurate interpretation of the outcome in an ecosystem
22. which statement is an accurate interpretation of the outcome in an ecosystem when a major predator is removed a. the remaining community adjusts and quickly becomes stable. b.…
22.What is the mRNA that will be produced. (Again start from the 5 prime end and
22.What is the mRNA that will be produced. (Again start from the 5 prime end and list each complementary RNA base in order all the way to the 3 prime end.) template) 23. What is t…
22.What type of radiation is increased on the earth as the ozone loves depleted?
22.What type of radiation is increased on the earth as the ozone loves depleted? a. infrared b. ultraviolet c. blue-violet d. visible spectrum 23 True or False. The United States …
222 Historical Geology Exercise 5-6 HURON QUADRANGLE, SOUTH DAKOTA Answer the fo
222 Historical Geology Exercise 5-6 HURON QUADRANGLE, SOUTH DAKOTA Answer the following qustions using Figure 5.9 a. Which deposits are younger, the stream deposits or the glacial…
222 LAB 8 | Modern Human Variation 2. Why might these similarities and differenc
222 LAB 8 | Modern Human Variation 2. Why might these similarities and differences exist? Be sure to consider the evolutionary context (including the nat- ural environment, cultur…
2260 A&P 1 Lecture - Unit 1 Beware! ANYTHING within the assigned readings or dis
                                                2260 A&P 1 Lecture - Unit 1 Beware! ANYTHING within the assigned readings or discussed in lecture is fair game whether it is pa…
228 3 Summative Assessment In 2004, a fossil of roseae. The Tik shown on the pho
228 3 Summative Assessment In 2004, a fossil of roseae. The Tik shown on the photograph of the fossil below an unknown vertebrate was discovered in northern Canada and subsequentl…
22q11.2 syndrome is an autosomal disorder caused by deletion of a 3 million bp s
22q11.2 syndrome is an autosomal disorder caused by deletion of a 3 million bp stretch of chromosome 22 which contains ~40 genes. One potential effect of this syndrome is early-on…
22q11.2 syndrome is an autosomal disorder caused by deletion of a 3 million bp s
22q11.2 syndrome is an autosomal disorder caused by deletion of a 3 million bp stretch of chromosome 22 which contains ~40 genes. One potential effect of this syndrome is early-on…
23 - Which of the following features would you not expect at an active continent
23 - Which of the following features would you not expect at an active continental margin? A - a broad continental shelf B - sedimentation in a trench C- subduction D -a benioff z…
23 Question(2 points) mical principle that protein structure determines protein
23 Question(2 points) mical principle that protein structure determines protein function is illustrated by green fluorescent protein (GFP), which is an autofluorescent protein iso…
23 Questions 1) What is the role of the products of alcoholic fermentation in th
23 Questions 1) What is the role of the products of alcoholic fermentation in the production of beer? In the production of bahed goods? In the production of wine? Yeasts and many …
23 Which of the following represents the annotation c.1462dupTA41 ?) 5\', ATCAC
23 Which of the following represents the annotation c.1462dupTA41 ?) 5', ATCAC TATA TACAGA TAJ' B)S ATCACTAATAATAACAGATA3 C)5ATCACTATACAGATA 3 . ATCACTATATATACAGATA 3 .ATCACTATATT…
23 and 24 explain. thanks 23. An organism has a diploid number of 20 in a primar
23 and 24 explain. thanks 23. An organism has a diploid number of 20 in a primary oocyte. (a) How many tetrads are present in prophase 1? (b) lHow many dyads are present in propha…
23 mom daughter son 1 son 2 The millionaire, Mr. Big, has just died. He has left
23 mom daughter son 1 son 2 The millionaire, Mr. Big, has just died. He has left behind a wife, daughter and a large inheritance. The news ofhis death has brought forth 2 men who …