Biology and Genetics

5\'... GCT AAGTATTGCTCAAGATTAGGATGATAAATAACTGG3\' 3\'... CGA TTCATAACGAGTTCTAATC

5'...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG3' 3'...CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC5' Sequence of wild-type DNA that encodes the last amino acids of a protein that is 270 am…

5\'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3\' 1. Copy this sequence, referring to

5'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3' 1. Copy this sequence, referring to it as “Strand A”, and directly below, give the sequence of its antiparallel, complementary strand as…

5\'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3\' 1. Copy this sequence, referring to

5'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3' 1. Copy this sequence, referring to it as “Strand A”, and directly below, give the sequence of its antiparallel, complementary strand as…

5a) A crazy cat lady has several dozen cats. Many of these cats are orange and t

5a) A crazy cat lady has several dozen cats. Many of these cats are orange and the orange allele is present p(ccl) = 0.75 in her population of cats. While moving west to a bigger …

5a) List the autapomorphic characters. 5b) List the seven character states that

5a) List the autapomorphic characters. 5b) List the seven character states that are present in lineages (branches) 1, 2, and 5. 5. The phylogeny below depicts hypothetical genus o…

5a. (1 point) Why are fungi more likely to germinate and thrive in jam, which is

5a. (1 point) Why are fungi more likely to germinate and thrive in jam, which is preserved by high sugar concentrations, than bacteria? a. specialization of tissues b. greater abi…

5a. Consider the figures below from Sherker etal. (2017) that show the response

5a. Consider the figures below from Sherker etal. (2017) that show the response of blue mussels to the presence or absence of dogwhelk (predator) effluent. For each figure, descri…

5b. The figures below show dogwhelk handling time (A) and the thickness of the m

5b. The figures below show dogwhelk handling time (A) and the thickness of the mussel shell at the site of the drill hole (B) for mussels exposed to dogwhelk cues and controls. Wh…

5f. As stated in the article, histidine residues are important mediators of the

5f. As stated in the article, histidine residues are important mediators of the Bohr effect. "In 0.1 M HEPES buffer with 0.1 M chloride, B146His contributes the most to the alkali…

5fe2+ + Mno4- +8H+ -----> 5Fe3+ +Mn2+ +4H2O determine Eo determmine delta G init

5fe2+ + Mno4- +8H+     -----> 5Fe3+ +Mn2+ +4H2O determine Eo determmine delta G initial and equilibrium constant K I know how to balance it back to initital but then after that…

5· Cabon uulhos bow many bonds with /4. Nocleotides are the bailding blacks fr d

5· Cabon uulhos bow many bonds with /4. Nocleotides are the bailding blacks fr d ATP, NAD+ and FAD. S. The fomcfuies from smali 6. Teanom diagnosticty associated withopie repeatin…

5· The fluid-filled area of the chloroplast is called the a. grana b. stroma c.

5· The fluid-filled area of the chloroplast is called the a. grana b. stroma c. thylakoids d. chloroplasm e. matrix Which of the following statements about visible light is FALSE?…

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAGTGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAG…

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAGTGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAG…

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAGTGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAG…

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGC

5’ - TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAGTGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAG…

5’ -TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCT

5’ -TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAGTGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAGC…

5’ -TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCT

5’ -TCAGATAAAAAACTGGCACGCAATCTGCAATTAGCAAGACATCTTTTTAGAACACGCTGAATAAATTGAGGTTGCTATGTCTATTGTGGTGAAAAATAACATTCATTGGGTTGGTCAACGTGACTGGGAAGTGCGTGATTTTCACGGCACGGAATATAAAACGCTGCGCGGCAGC…

5’-GGGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCT-3’ 3’-CCCCAA-------------TCACCATCTCGCG

5’-GGGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCT-3’ 3’-CCCCAA-------------TCACCATCTCGCGAACGGA-5’ a) In the above DNA sequence, what sequence will fit in the missing portion? b) If you al…

5’GGCTATATATTACCGATGAGGCGTTCGAATGACTAGCTACACATTATAACGAATTTT3’ 3’CCGATATATAATGGCT

5’GGCTATATATTACCGATGAGGCGTTCGAATGACTAGCTACACATTATAACGAATTTT3’ 3’CCGATATATAATGGCTACTCCGCAAGCTTACTGATCGATGTGTAATATTGCTTAAAA5’ • The promoter for the gene is: 5’ TATATATT -3’ • The t…

6 (5 of 19) Given the sequence of the peptide below state which of the following

6 (5 of 19) Given the sequence of the peptide below state which of the following is true? Note: HAT is the N-terminal a-amino group and CO is the C-terminal a-carboxyl group. H3Nt…

6 (5 of 20) The more we learn about protein folding the more we understand that

6 (5 of 20) The more we learn about protein folding the more we understand that the process is the result of the minimization of free energy and the final structure will sit in a …

6 . Christine, a woman of Northern European genetic descent, brings her 6-month-

6. Christine, a woman of Northern European genetic descent, brings her 6-month-old infant to the pediatrician. The baby has a persistent deep cough with thick mucus, and the probl…

6 . Christine, a woman of Northern European genetic descent, brings her 6-month-

6. Christine, a woman of Northern European genetic descent, brings her 6-month-old infant to the pediatrician. The baby has a persistent deep cough with thick mucus, and the probl…

6 .A) If one follows 120 primary oocytes in an animal through their various stag

6.A) If one follows 120 primary oocytes in an animal through their various stages of oogenesis, how many secondary oocytes would be formed? B) How many first polar bodies would be…

6 21 FIGURE Q23 23. Analyze the diagram of FIGURE Q23 and choose the correct sta

6 21 FIGURE Q23 23. Analyze the diagram of FIGURE Q23 and choose the correct statement. A. Layer E is older than fault FF'. B. Layer B is older than layer D. C. Layer C is older t…

6 A disease or condition with clinically distinct symptoms, whose incidence has

6 A disease or condition with clinically distinct symptoms, whose incidence has increased, especially in the past two decades, is called ________. Select one: a. declining b. emer…

6 A) Which of the following statements regarding PI-3 kinase signaling is NOT tr

6 A) Which of the following statements regarding PI-3 kinase signaling is NOT true? Loss of function mutations in PTEN cause excessive PI-3K signaling and are found in many human …

6 Broadcast spawners such as abalones and urchins need to overcome two issues to

6 Broadcast spawners such as abalones and urchins need to overcome two issues to accomplish fertilization. Dilution. Gametes are released into the vastness of the ocean. What stra…

6 CO_2, 30 ATP, and 2 pyruvate. In glycolysis, for each molecule of glucose oxid

6 CO_2, 30 ATP, and 2 pyruvate. In glycolysis, for each molecule of glucose oxidized to pyruvate. A) two molecules of ATP are used and two molecules of ATP are produced. B) two mo…

6 CO_2, 30 ATP, and 2 pyruvate. In glycolysis, for each molecule of glucose oxid

6 CO_2, 30 ATP, and 2 pyruvate. In glycolysis, for each molecule of glucose oxidized to pyruvate. A) two molecules of ATP are used and two molecules of ATP are produced. B) two mo…

6 Consider a pair of snail species that live on either side of a deep and wide c

6 Consider a pair of snail species that live on either side of a deep and wide canyon. Snail species A occurs west of the canyon and snail species B occurs east of the canyon. Phy…

6 Halo-Lic vector (Smal digested) (all) How would you tell the PCR reaction work

6 Halo-Lic vector (Smal digested) (all) How would you tell the PCR reaction works? How would you tell the Smal digestion reaction works? For linear DNAs, what is the relationship …

6 Human polyomavirus (PoV) can cause cancer, but it is not known exactly how. Po

6 Human polyomavirus (PoV) can cause cancer, but it is not known exactly how. PoV integrates into the human DNA in the middle of a gene called MyBPC, which is a myosin binding pro…

6 Identify the following characteristics or examples as belonging to the phyla H

6 Identify the following characteristics or examples as belonging to the phyla Hepatophyta, Anthocerophyta, or Bryophyta, using the following key (some choices may pertain to two …

6 In the mineral zircon (Zrsio.), zirconium (z ) is in cubic coordination (light

6 In the mineral zircon (Zrsio.), zirconium (z ) is in cubic coordination (light gray polyhedra) with oxygen and silicon (Sify is in tetrahedral coordination (dark gray polyhedra)…

6 Instructions (1)-Microsoft Word Mailings ReviewView A A-Normal No Spad...Headi

6 Instructions (1)-Microsoft Word Mailings ReviewView A A-Normal No Spad...Heading 1 Heading 2 TitleSubtite Paragraph Styles Answer the following questions in 1-2 pages (within th…

6 List four contrasting features of monocot roots and dicot roots as seen in cro

6 List four contrasting features of monocot roots and dicot roots as seen in cross section. Use Ranunculus (23) and Smilax as examples. 7 List three contrasting features betweon d…

6 Number the following from the point the filtrate is first formed (with a numbe

6 Number the following from the point the filtrate is first formed (with a number 1) to the point it drains inss he renal pelvis (with a number 10). Major calyx Minor caly Proxima…

6 Number the following from the point the fitrate is first f point the filtrate

6 Number the following from the point the fitrate is first f point the filtrate is first formed (with a number 1) to the point it drains into the th a number to)e point the filtra…

6 Pedigres a (s points) a. Could this trait be inherited as a simple autosomal r

6 Pedigres a (s points) a. Could this trait be inherited as a simple autosomal recessive? b. Could this trait be inherited as a simple autosomal dominant? e. Could this trait be i…

6 Problem 2. (6 points). The Y chromosome contains two genes for protein 4 of th

6 Problem 2. (6 points). The Y chromosome contains two genes for protein 4 of the small ribosomal subunit (RPS4YI and RPS4Y2). These genes belong to the NRY 1 gene class. The gene…

6 Questions Compare the Earth of today to that of 250 million years ago. Describ

6 Questions Compare the Earth of today to that of 250 million years ago. Describe a few examples of how the continents have changed over time.    Describe the processes of magneti…

6 R14.?,4 89%0 10:11 PM Announcements Favorite consider birds to be one type of

6 R14.?,4 89%0 10:11 PM Announcements Favorite consider birds to be one type of reptile? What traits do birds share with reptiles? 32) What are the characteristics of mammals? Wha…

6 Staphylococci can readily be differentiated from streptococci in that: a) Gram

6 Staphylococci can readily be differentiated from streptococci in that: a) Gram stain smear will show different arrangements d) Only A and C above Only A and B above 7) Character…

6 The advantage of having many nuclei in a skeletal muscle fiber is A) the abili

6 The advantage of having many nuclei in a skeletal muscle fiber is A) the ability to contract. B) the ability to produce more ATP with little oxygen. C) the ability to repair the…

6 The presence of blood and/or casts in the urine can indicate a an indicate a s

6 The presence of blood and/or casts in the urine can indicate a an indicate a serious lddney problen. Why are Jad ney problems so serions ditfering from the norn (e.g color, pH, …

6 To establish a link between a specific bacterium and an eye infection, researc

6        To establish a link between a specific bacterium and an eye infection, researchers have shown that the bacterium is present in affected individuals but not in healthy ind…

6 True/False: Mark the following statements as true (T) or fakse (F), If the sta

6 True/False: Mark the following statements as true (T) or fakse (F), If the statement is false, correct it to make it a true statement. a The umbilical arteries carry cxygenated …

6 Truelfalse: Mark the following statements as true (T) or false (F). If the sta

6 Truelfalse: Mark the following statements as true (T) or false (F). If the statement is false, correct it to make it a true statement. a. Gametes result from two rounds of cell …