Biology and Genetics
101624 questions • Page 40 / 2033
1) ACE inhibitors can lower blood pressure because inhibiting ACE stops the secr
1) ACE inhibitors can lower blood pressure because inhibiting ACE stops the secretion of renin prevents the formation of angiotensin I prevents the formation of angiotensis II inc…
1) ATP hydrolysis provides the energy for this reaction: X + Y + ATP Z +
1) ATP hydrolysis provides the energy for this reaction: X + Y + ATP <----> Z + ADP + Pi , which would otherwise be endergonic. The mechanism by which this occurs is that …
1) ATP hydrolysis provides the energy for this reaction: X + Y + ATP Z +
1) ATP hydrolysis provides the energy for this reaction: X + Y + ATP <----> Z + ADP + Pi , which would otherwise be endergonic. The mechanism by which this occurs is that …
1) ATTENTION AND PROCESSING (40 pts) Explain the concepts of bottom-up versus to
1) ATTENTION AND PROCESSING (40 pts) Explain the concepts of bottom-up versus top-down processing. Cite examples from our lecture material that are examples of both and justify wh…
1) According to Diamond, what were the primary causes of the conflict in Rwanda?
1) According to Diamond, what were the primary causes of the conflict in Rwanda? Based on your research of the resources provided, what was the primary cause of the Civil War in t…
1) According to the biological species concept, a group of organisms is consider
1) According to the biological species concept, a group of organisms is considered a separate species if it __________ from other groups of organisms. A) is physically different B…
1) According to the formula, as air density increases, the wind speed above the
1) According to the formula, as air density increases, the wind speed above the level of friction will also increase. True False 2) A _________ absorber is a gas in the atmosphere…
1) After analyzing several karyotypes, you have just found an interesting chromo
1) After analyzing several karyotypes, you have just found an interesting chromosome variation at 5p15.2. Explain how you would describe the location of this variation to someone …
1) After mixing a heat-killed, infectious smooth strain of bacteria with a livin
1) After mixing a heat-killed, infectious smooth strain of bacteria with a living non-infectious rough strain, you discover that some of the living cells are now infectious. Which…
1) After suffering from a stroke,Laura finds that she cannot move the right arm.
1) After suffering from a stroke,Laura finds that she cannot move the right arm. This would suggest tha the stroke damage is in the area of which lobe. 2) After suffering from a b…
1) After the Stock Market collapse of 1929, the economy was made worse by all of
1) After the Stock Market collapse of 1929, the economy was made worse by all of the following except a. bank failures b. massive layoffs of workers c. overextension of credit buy…
1) After transcription, nuclear RNA is capped, polyadenylated, spliced. After su
1) After transcription, nuclear RNA is capped, polyadenylated, spliced. After successful splicing, proteins are added to the mature mRNA at the exon junction complex and then tran…
1) Albert Kossel used X-ray diffraction to examine the structure of DNA determin
1) Albert Kossel used X-ray diffraction to examine the structure of DNA determined that DNA contains four different nitrogenous bases found that "the transforming principle" is de…
1) All of the following are correctly matched except _____. a. C-terminal domain
1) All of the following are correctly matched except _____. a. C-terminal domain: phosphorylation site in RNA polymerase II b. elongation of transcription: core enzyme c. TFIIH: h…
1) All of the following are mHealth technology categories except: Individuals co
1) All of the following are mHealth technology categories except: Individuals communicating to health services Health information access Health services communicating to individua…
1) All of the following are vectors used to transfer genes to different cells Ex
1) All of the following are vectors used to transfer genes to different cells Except: a) bacteriophages b) YACs c) BACs d) ARs e) plasmids 2) Which refers to the gain of …
1) All the following compromise immunity to infection, except ____________. A. P
1) All the following compromise immunity to infection, except ____________. A. Pregnancy B. Antimicrobials C. Malnutrition D. Microbiota E. Chemotherapy 2) A common etiologic agen…
1) Although downstream to the commitment step of glycolysis, pyruvate kinase is
1) Although downstream to the commitment step of glycolysis, pyruvate kinase is also an important point of glycolytic control by allosteric regulation. Explain the significance of…
1) Although plants do NOT have nervous systems they do have neurotransmitters. P
1) Although plants do NOT have nervous systems they do have neurotransmitters. Please state what neurotransmitters have been discovered in plants. Do scientists know what the role…
1) Amylopectin and glycogen are both branched polysaccharides. Let us say that a
1) Amylopectin and glycogen are both branched polysaccharides. Let us say that a large sample of each polymer was available and each sample was made up of an identical number of g…
1) An E. coli culture is growing exponentially at 37 o C in minimal-glycerol med
1) An E. coli culture is growing exponentially at 37oC in minimal-glycerol medium with a generation (doubling) time of 120 min. a) If the birth length (LB) of cells in…
1) An Hfr E. coli contains the following genetic traits: lac+ , kans , his+ , le
1) An Hfr E. coli contains the following genetic traits: lac+ , kans , his+ , leu+ , strr . It is mated with a recipient E. coli that contains the opposite genetic traits. Note th…
1) An advantage to sexual reproduction is A) that there is no need to find a mat
1) An advantage to sexual reproduction is A) that there is no need to find a mate. B) the potential for high population growth. C) that offspring are adapted to the local environm…
1) An individual is heterozygous for 3 genes (A/a B/b and C/c). He is crossed to
1) An individual is heterozygous for 3 genes (A/a B/b and C/c). He is crossed to an individual that is homozygous recessive for the same 3 genes (a/a b/b and c/c). The following o…
1) An object with a height of 4.0 cm is at a position of 6.0 cm in front of a co
1) An object with a height of 4.0 cm is at a position of 6.0 cm in front of a converging lens. The image inverts and is at a position 3.0 cm from the lens. The image height is 2) …
1) Answer parts a through VV. a) The scientist that contributed most to the deve
1) Answer parts a through VV. a) The scientist that contributed most to the development of pure culture techniques was b) The solidifying agent used most successfully in bacterial…
1) Answer the following question as True or False (1 point each a) TorF: The tot
1) Answer the following question as True or False (1 point each a) TorF: The total value of domestically produced raw minerals in the year 2013 was about $100 million. b) TorF: In…
1) Apoptosis or programmed cell death, occurs in all ofthe following cases excep
1) Apoptosis or programmed cell death, occurs in all ofthe following cases except a) virus-infected cells b)in cells damaged by injury c)in cells with potentially cancer-causing m…
1) Are these two tetrapeptides the same chemical substance: HaN-Val-Gly-Ala-Ser-
1) Are these two tetrapeptides the same chemical substance: HaN-Val-Gly-Ala-Ser-COO O0C-Val-Gly-Ala-Ser-NHs ubalan pathways drive anh In metabolism (this word alone is a hint. pat…
1) As a biology student,you have worked with lots of textbooks that show detaile
1) As a biology student,you have worked with lots of textbooks that show detailed cartoons of the organelles and parts of the cell. How do these cartoons compare to the level of i…
1) As they relate to animal body plans, define the positional adjectives: anteri
1) As they relate to animal body plans, define the positional adjectives: anterior, posterior, ventral and dorsal. 2) Thinking back to the previous lab and the Amphiuma intestine,…
1) Assume independent assortment and start with a plant that is dihybrid A/a ; B
1) Assume independent assortment and start with a plant that is dihybrid A/a ; B/b a. What phenotypic ratio is produced from selfing it? b. What genotypic ratio is produced from s…
1) Assume that the height of a type of bean plants is determined by five unlinke
1) Assume that the height of a type of bean plants is determined by five unlinked genes called A, B, C, D, and E, and each gene has two alleles: additive (uppercase letter) and no…
1) Assume that the ratio of females to males is 1:1. A couple already has two da
1) Assume that the ratio of females to males is 1:1. A couple already has two daughters and no sons. If they plan to have a total of six children, what is the probability that the…
1) At the beginning of metaphase 1, the two homologous chromosomes of a tetrad a
1) At the beginning of metaphase 1, the two homologous chromosomes of a tetrad are held together by?? a. centromeres b. terminal chiasma c.synaptonemal complexes d. kinetochores 2…
1) At the end of a race a runner decelerates from a velocity of 7.00 m/s at a ra
1) At the end of a race a runner decelerates from a velocity of 7.00 m/s at a rate of 0.500 m/s2. (a) How far does she travel in the next 14.0 s? m (b) What is her final velocity?…
1) At what point is the amount of oxygen at its highest? in the capillaries duri
1) At what point is the amount of oxygen at its highest? in the capillaries during strenous activity in the lungs in the capillaries at rest in muscle tissue during strenous activ…
1) At which time point would the postsynaptic membrane potential from a second s
1) At which time point would the postsynaptic membrane potential from a second stimulus be the greatest? What molecular process can explain this phenomenon? 2) What are the four t…
1) Atopic diseases. In your own words, what is the hygiene hypothesis? What is b
1) Atopic diseases. In your own words, what is the hygiene hypothesis? What is believe to be its role in increasing susceptibility to allergic diseases? 2) Bacteria that can enter…
1) Australopithecines were the ancestors of modern humans. Select all of the phr
1) Australopithecines were the ancestors of modern humans. Select all of the phrases that accurately describe australopithecines. Check All That Apply Flat skull baseFlat skull ba…
1) Based on the abundant fossil records, only 10,000 years ago, two-thirds of th
1) Based on the abundant fossil records, only 10,000 years ago, two-thirds of the 150 genera of the Pleistocene megafauna that were present 40,000 years earlier had gone extinct. …
1) Based on the pH of solution A, what is the pKa of acetic acid? Over what rang
1) Based on the pH of solution A, what is the pKa of acetic acid? Over what range of pH values would an acetic acid/acetate buffer be effective? 2) Based on the pH of solution B, …
1) Based on the sequence of the gene shown below, which of the four is the least
1) Based on the sequence of the gene shown below, which of the four is the least related? Animal A: AATTCGTGCGCTAACCGATA Animal B: AATTCGTGCGCTAACCTATA Animal C: AATTCGTGCGCTAAG…
1) Based on your results for flagella regeneration; calculate how many amino aci
1) Based on your results for flagella regeneration; calculate how many amino acids are being polymerized per minute into the tubulin component of the regenerating flagella. 2) Ass…
1) Based on your results for flagella regeneration; calculate how many amino aci
1) Based on your results for flagella regeneration; calculate how many amino acids are being polymerized per minute into the tubulin component of the regenerating flagella. 2) Ass…
1) Bax and Bak act by a) interacting with Apaf-1 to initiate a proapoptoticsigna
1) Bax and Bak act by a) interacting with Apaf-1 to initiate a proapoptoticsignal b)interacting with Ced-9 to initiate a poapoptoticsignal c)forming oligomers in the mitochondrial…
1) Because of prolonged drought, the trees on an island are producing nuts that
1) Because of prolonged drought, the trees on an island are producing nuts that are much smaller with thicker and harder shells. What will happen to the birds that depend on the n…
1) Before DNA sequencing, how were scientists able to determine the identity and
1) Before DNA sequencing, how were scientists able to determine the identity and number of chromosomes a person had? 2) What is scientifically accurate about the assumption that t…
1) Below are several steps in isolating cDNA that encodes protein X found in the
1) Below are several steps in isolating cDNA that encodes protein X found in the brain tissue. From the choices available (a,b,c or d), select the sequential order of steps (1-4) …
1) Below are two homologous chromosomes – one with an inversion. A crossover occ
1) Below are two homologous chromosomes – one with an inversion. A crossover occurs between the D and E genes. Below, select what type of inversion is seen here, and all of the po…
Subject
Biology and Genetics
Use Browse or pick another subject.