Academic Integrity: tutoring, explanations, and feedback — we don’t complete graded work or submit on a student’s behalf.

Browse 0-9

Alphabetical listing with fast deep pagination.
131141 items • Page 2308 / 2623

All 0-9 A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
5:58 PM 28% ooooo T-Mobile LTE organic.cc.stonybrook.edu The data for the absorb
5:58 PM 28% ooooo T-Mobile LTE organic.cc.stonybrook.edu The data for the absorbance measurements of the reaction mixture at 498 nm (the analytical wavelength of the dye) is given…
5:58 PM 28% ooooo T-Mobile LTE organic.cc.stonybrook.edu The data for the absorb
5:58 PM 28% ooooo T-Mobile LTE organic.cc.stonybrook.edu The data for the absorbance measurements of the reaction mixture at 498 nm (the analytical wavelength of the dye) is given…
5:58 PM 78% shows the different categories of calculated ratios for Elvis Produc
5:58 PM 78% shows the different categories of calculated ratios for Elvis Products International. 2. Define each ratio (except 11, 16, & 18) and write what each ratio indicate…
5:581 Discussion Details 6191-PSYC-2301-General Psychology-RT-16971 Back ExamI E
5:581 Discussion Details 6191-PSYC-2301-General Psychology-RT-16971 Back ExamI Essay 100 pts Choose one of the following to discuss using lecture notes, textbook or other academic…
5:59 PM beat being generated in Rs .11 T-Mobile A. 20 W C.60 W D. 12 W R, 6 Whic
5:59 PM beat being generated in Rs .11 T-Mobile A. 20 W C.60 W D. 12 W R, 6 Which statements about the cirut are correct? All metens are con- mknd to be ideal, the conorting kwh h…
5:In each part below, give a m × n matrix R in reduce rou-echelon form satisfyin
5:In each part below, give a m × n matrix R in reduce rou-echelon form satisfying the given condition, or explain briefly why it is impossible to do so. (a) m = 3, n 4, and the eq…
5A )Which of the following is required for canonical regulated protein degradati
5A )Which of the following is required for canonical regulated protein degradation? 1. E1 ubiquitin ligase 2. proteasome 3. E2 ubiquitin ligase 4. E3 ubiquitin ligase 5. ubiquitin…
5A Determining the effects of financing alternatives on ratios Erercise 10.2 omp
5A Determining the effects of financing alternatives on ratios Erercise 10.2 omposite Solutions Company (CSC) has the following account balances: Current liabilities $100,000 350,…
5A) What is the initial speed of the projectile? 5B) What is the initial angle o
5A) What is the initial speed of the projectile? 5B) What is the initial angle of the projectile? 5C) What is the x velocity of the projectile 0.800s? 5D) What is the y velocity o…
5A-1 FV CONTINUOUS COMPOUNDING If you receive $15,000 today and can invest it at
5A-1 FV CONTINUOUS COMPOUNDING If you receive $15,000 today and can invest it at a 6% annual rate compounded continuously, what will be your ending value after 15 years? 5A-2 PV C…
5A-5 CONTINUOUS COMPOUNDING You have the choice of placing your savings in an ac
5A-5 CONTINUOUS COMPOUNDING You have the choice of placing your savings in an account paying 10.25% compounded annually, an account paying 10.1% compounded semiannually, or an acc…
5A. (10 points) Use these results from each peak to calculate a molecular mass f
5A. (10 points) Use these results from each peak to calculate a molecular mass for porcine insulin. Compare these results to the known/accepted values for its molecular mass (a we…
5A. Although we did not discuss this in detail in class, it turns out that caref
5A. Although we did not discuss this in detail in class, it turns out that careful measurements show that water is slightly higher in density at 4 ?C than at any other temperature…
5A. Bond valuation Bond X is noncallable and has 20 years to maturity, a 8% annu
5A. Bond valuation Bond X is noncallable and has 20 years to maturity, a 8% annual coupon, and a $1,000 par value. Your required return on Bond X is 10%; and if you buy it, you pl…
5A. In mid-February 2008, President Bush and Congress approved a $168 billion st
5A. In mid-February 2008, President Bush and Congress approved a $168 billion stimulus package that will provide tax rebates to all taxpayers, that is to those who file their tax …
5A. Visceral leishmaniasis has a very high case fatality rate but is difficult t
5A. Visceral leishmaniasis has a very high case fatality rate but is difficult to diagnose: bone marrow biopsy, one of the best diagnostic methods, is expensive and is often assoc…
5A. White light shines on a thin film of oil (n=1.6) sitting on top of water (n=
5A. White light shines on a thin film of oil (n=1.6) sitting on top of water (n=1.33). Blue light (4700 A) is reflected. How thick is the oil? Please give at least three possible …
5A2 (Please read all parts of the question before answering) Please stop spammin
5A2 (Please read all parts of the question before answering) Please stop spamming my post.) Review the Public Health Preparedness Capabilities at got to the CDC.gov website. Pick …
5Aga) Please highlight answers Please type or write neatly and legible Discuss t
5Aga) Please highlight answers Please type or write neatly and legible Discuss the different roles played by the qualitative and quantitative approsches to managerial decision mak…
5Apossible set of quantum numbers to describe an electron in a 5Bsubshell is (1)
5Apossible set of quantum numbers to describe an electron in a 5Bsubshell is (1)n=5,1 m:2. m,.+1 (2) n = 5. 1:3, mr . 0, m, . . ½ (3) n#5. e:0, me-o,ma..½ @n=s,1.mao. 6. The orbit…
5As (3ets for a. 2 pts each for b-d-9 pts total) A researcher is interested in t
5As (3ets for a. 2 pts each for b-d-9 pts total) A researcher is interested in the effects of cocalne on earning A group of rats is randomly assigned to one of two solution condit…
5B. Please answer questions, need help THANK YOU! 1. Figure 1 is the surface wea
5B. Please answer questions, need help THANK YOU! 1. Figure 1 is the surface weather map for 16Z 26 SEP 2017. Little Rock, Arkansas, had a temperature and dewpoint of 82°F and 69°…
5Br-(aq) + BrO3-(aq) + 6H+(aq) --> 3Br2(l) + 3H2O(l ) The above reaction is expe
5Br-(aq) + BrO3-(aq) + 6H+(aq) --> 3Br2(l) + 3H2O(l) The above reaction is expected to obey the mechanism: BrO3-(aq) + H+(aq) = HBrO3(aq) Fast equilibrium HBrO3(aq) + H+(aq) = …
5Br-(aq) + BrO3-(aq) + 6H+(aq) --> 3Br2(l) + 3H2O(l) The above reaction is expec
5Br-(aq) + BrO3-(aq) + 6H+(aq) --> 3Br2(l) + 3H2O(l) The above reaction is expected to obey the mechanism: For each of the given rate expressions 1. -d[BrO3-]/dt 2. -d[H+]/dt 3…
5C) What percentage of samples of Answer this size scored higher, on average, th
5C) What percentage of samples of Answer this size scored higher, on average, than the students in Ms. Kay's class? DO NOT ROUND ts Answer 5D) What percentage of samples of this s…
5C2O42- + 2MnO4- + 16H+ ?10CO2 + 2Mn2+ + 8H2O A 0.250 g sample of Na2C2O4 requir
5C2O42- + 2MnO4- + 16H+ ?10CO2 + 2Mn2+ + 8H2O A 0.250 g sample of Na2C2O4 requires 22.15 mL of a certain KMnO4 solution to reach the end point during a titration.  What is the con…
5CH3C(=O)H (supposed to be an aldehyde group) + 2MnO4- + 6H+ --> 5CH3C(=O)OH (a
5CH3C(=O)H (supposed to be an aldehyde group) + 2MnO4- + 6H+ --> 5CH3C(=O)OH (a carboxyl group) + 2Mn 2+ +3 H2O. I'm supposed to tell which is the oxidizing agent and which is …
5CH3C(=O)H (supposed to be an aldehyde group) + 2MnO4- + 6H+ --> 5CH3C(=O)OH (a
5CH3C(=O)H (supposed to be an aldehyde group) + 2MnO4- + 6H+ --> 5CH3C(=O)OH (a carboxyl group) + 2Mn 2+ +3 H2O. I'm supposed to tell which is the oxidizing agent and which is …
5February 08 Repairs and Maintenance Expense Cash Required Information March 01B
5February 08 Repairs and Maintenance Expense Cash Required Information March 01Buildings 153,000 153,000 The following intormation applies to the questions displiayed below Cash N…
5For the reaction A+B+CD+E, the initial reaction rate was measured for various i
5For the reaction A+B+CD+E, the initial reaction rate was measured for various initial concentrations of reactants. The following data were collected: Trial [A] (M) [B] (M) [C] (M…
5In Durkheim’s famous work on suicide, the most important thing he found was tha
5In Durkheim’s famous work on suicide, the most important thing he found was that people kill themselves most often when they experience a loss in their life atheists are less lik…
5Note: 1) Answers need to be clearly legible. 2) Each answer must be explained a
5Note: 1) Answers need to be clearly legible.    2) Each answer must be explained as to the reasoning behind it so I can learn it.    3) Take your time and make it comprehensive. …
5Partnership Homework × filef/C:/Users/ashle/Downloads/Partnership FALL%20201 7%
5Partnership Homework × filef/C:/Users/ashle/Downloads/Partnership FALL%20201 7%20(1).pdf ACC 102 FALL 2017 - PARTNERSHIP HOME WORK -ATTEMPT BOTH QUESTIONS FOR MoNDAY NOV. 20 HH a…
5Pd, and the market supply curve is given by Qd 35Ps. of price controls. price c
5Pd, and the market supply curve is given by Qd 35Ps. of price controls. price ceiling of this magnitude? What is the size of the shortage created by the price ceiling? is the net…
5S A eountry nust agree to the e a. European Union b. International Monetary Fun
5S A eountry nust agree to the e a. European Union b. International Monetary Fund c. Group of Eight d. World Trade Organization of TRIPS nm osder to yoin de e, NAFTA 56. The benef…
5Take Test: Final Exam-xt O n https/mdc.blackboard.com/webapps/assessment/take/l
5Take Test: Final Exam-xt O n https/mdc.blackboard.com/webapps/assessment/take/launchjspicour D QUESTION 25 Label the below chart according to the four main elements of supply cha…
5The payments to the factors of production are: wages. rent. rent and interest.
5The payments to the factors of production are: wages. rent. rent and interest. wages, rent, interest, and profits. 6Over time Americans have chosen to cook less at home and dine …
5U The renal corpuscle has two components: the glomerulus and Bowman\'s capsule
5U The renal corpuscle has two components: the glomerulus and Bowman's capsule S7 The first portion of the loop of Henle dips into the medula where i is called the ascending limb …
5When the government\'s budget deficit increases a. the government is borrowing
5When the government's budget deficit increases a. the government is borrowing less and public savings falls. b. the government is borrowing less and public savings increases. c. …
5Which of the following is not a characteristic of an oligopolistic industry? Su
5Which of the following is not a characteristic of an oligopolistic industry? Substantial barriers to entry. The output produced by the firms in the industry may be homogeneous or…
5[E]) You\'ve just bought a framed, vintage 43 in by 30 in poster of your favori
5[E]) You've just bought a framed, vintage 43 in by 30 in poster of your favorite movie. The frame has two hooks on the upper-left and upper-right corners and you have two thin, 3…
5\' 1) Daniel is trying to design a PCR primer that will only bind once, on the
5' 1) Daniel is trying to design a PCR primer that will only bind once, on the gene above (only the bottom strand is shown for simplicity) Where will the primer TCCTGA bind? Draw …
5\' 96. A eukaryotic translation complex during the elongation stage is represen
5' 96. A eukaryotic translation complex during the elongation stage is represented by the diagram above. Which of the following labels on the diagram is NOT correct? (A) Location …
5\' AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA3 mRNA Codon AUG -start codon AUU UUG Corre
5' AUGAUUUUGUACCCAGCCAAAGAAGGGCGAUGA3 mRNA Codon AUG -start codon AUU UUG Corresponding Amino Acid MET ILE LEU it .For the following DNA template strand, determine the mRNA strand…
5\' TCAG TCATAATCCCAT GGAC GCG ATTATA GCTAGCTAGCTA TGTCAA 3\' Above is the seque
5' TCAG TCATAATCCCAT GGAC GCG ATTATA GCTAGCTAGCTA TGTCAA 3' Above is the sequence of a DNA strand from part of a bacterial gene. Use it to answer the following questions. (HINT: s…
5\'- G GAATGAACCAAGCTAGC3 3-CCT TACTTGGTTCGATCG-5 region of the DNA sequence abo
5'- G GAATGAACCAAGCTAGC3 3-CCT TACTTGGTTCGATCG-5 region of the DNA sequence above could have a restriction enzyme cut site? a) I b) II c) IlI VIRUS Questions 30 and 31 refer to th…
5\'... GCT AAGTATTGCTCAAGATTAGGATGATAAATAACTGG3\' 3\'... CGA TTCATAACGAGTTCTAATC
5'...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG3' 3'...CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC5' Sequence of wild-type DNA that encodes the last amino acids of a protein that is 270 am…
5\'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3\' 1. Copy this sequence, referring to
5'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3' 1. Copy this sequence, referring to it as “Strand A”, and directly below, give the sequence of its antiparallel, complementary strand as…
5\'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3\' 1. Copy this sequence, referring to
5'TCGCATGCGCGTGAGCAACAGGTCTACGCCGTGAAAT 3' 1. Copy this sequence, referring to it as “Strand A”, and directly below, give the sequence of its antiparallel, complementary strand as…
5] A circuit you\'re building needs an ammeter that goes from 0 mA to a full-sca
5] A circuit you're building needs an ammeter that goes from 0 mA to a full-scale reading of 50 mA. Unfortunately, the only ammeter in the storeroom goes from 0 to a full-scale re…