Biology and Genetics

Which of the following statements about the fundamental and realized niche are t

Which of the following statements about the fundamental and realized niche are true? Check all that apply: A species' realized niche could be the same size as its fundamental nich…

Which of the following statements about the hypothalamus is endocrine gland, b)

Which of the following statements about the hypothalamus is endocrine gland, b) It is part of the central nervous system, c) It is subject to feedback inhibition by certain hormon…

Which of the following statements about the life cycle of mosses is FALSE ? Moss

Which of the following statements about the life cycle of mosses is FALSE ? Moss sperm are flagellated and need water to reach the egg. Haploid spores are the major means of dispe…

Which of the following statements about the logistic model of population growth

Which of the following statements about the logistic model of population growth is incorrect? It fits an S-shaped curve It incorporates the concept of carrying capacities If descr…

Which of the following statements about the management of a myocardial infarctio

Which of the following statements about the management of a myocardial infarction is FALSE? Question 3 options: It's a high priority to dissolve the blood clot in the coronary art…

Which of the following statements about the management of a myocardial infarctio

Which of the following statements about the management of a myocardial infarction is FALSE? Question 3 options: It's a high priority to dissolve the blood clot in the coronary art…

Which of the following statements about the movement of sucrose in phloem is FAL

Which of the following statements about the movement of sucrose in phloem is FALSE? A. The loading of sucrose molecules into phloem involves a type of active transport and a membr…

Which of the following statements about the organization of complex multicellula

Which of the following statements about the organization of complex multicellular organisms is FALSE? Question 5 options: Only some cells are in direct contact with the environmen…

Which of the following statements about the oxidative decarboxylation of pyruvat

Which of the following statements about the oxidative decarboxylation of pyruvate under aerobic conditions in animal cells is correct? The methyl group is eliminated as CO_2 The p…

Which of the following statements about the polymerase chain reaction (PCR) is f

Which of the following statements about the polymerase chain reaction (PCR) is false? (A) DNA amplified by PCR can be cloned. (B) DNA is amplified at many points within a cellular…

Which of the following statements about the positive control of gene expression

Which of the following statements about the positive control of gene expression are true? Check all that apply. The regulatory molecule needs to be provided to the DNA for transcr…

Which of the following statements about the positive control of gene expression

Which of the following statements about the positive control of gene expression are true? Check all that apply. The regulatory molecule needs to be provided to the DNA for transcr…

Which of the following statements about the predictions derived from hypotheses

Which of the following statements about the predictions derived from hypotheses for the evolution of cognitive complexity in primates is TRUE? Select one: a. The social intelligen…

Which of the following statements about the principles of drug therapy is INCORR

Which of the following statements about the principles of drug therapy is INCORRECT? (a) A narrow therapeutic index means the difference between a therapeutic dose and a toxic dos…

Which of the following statements about the process of transcription is FALSE? T

Which of the following statements about the process of transcription is FALSE? Transcription begins at the start codon and ends at the stop codon. RNA polymerase is recruited to t…

Which of the following statements about the proposed mechanism for ATP synthsis

Which of the following statements about the proposed mechanism for ATP synthsis by ATP are correct? A. ATP synthase forms ATP only when protons flow through the complex B. ATP syn…

Which of the following statements about the proton motive force (PMF) is TRUE? T

Which of the following statements about the proton motive force (PMF) is TRUE? The PMF requires the concentration of protons on the inside of the cytoplasmic membrane to be higher…

Which of the following statements about the relationship between latitude and bi

Which of the following statements about the relationship between latitude and biome distribution is most accurate? Latitude affects biome distribution; increasing elevation create…

Which of the following statements about the role of the COPI or COPII proteins i

Which of the following statements about the role of the COPI or COPII proteins in vesicular transport is CORRECT? They pinch and fuse the membrane to allow separation of the vesic…

Which of the following statements about the standard genetic code is NOT true? -

Which of the following statements about the standard genetic code is NOT true? - Transversions at the third codon position rarely change the amino acid specified. - Transversions …

Which of the following statements about the structure of DNA molecules is true?

Which of the following statements about the structure of DNA molecules is true? There are three hydrogen bonds between AT pairs. The nucleotides are arranged in a linear, unbranch…

Which of the following statements about the structure of microtubules is false?

Which of the following statements about the structure of microtubules is false? A. Microtubules are built from protofilaments that come together to make a hollow structure. B. The…

Which of the following statements about the ‘medication use process’ is UNTRUE?

Which of the following statements about the ‘medication use process’ is UNTRUE? (a) The process begins when patients perceive a change from normal for them in terms of their physi…

Which of the following statements about thermohaline circulation is FALSE? a. A

Which of the following statements about thermohaline circulation is FALSE? a. A complete circuit beginning with downwelling in the near Greenland and ending with upwelling in the …

Which of the following statements about this particular sequence of mRNA is true

Which of the following statements about this particular sequence of mRNA is true? (use genetic 3' AUGUCGAAUUGUAAAGGUUGAUACCAUGUACCGU 5 code in the lab manual if needed)YY #4 #1 #2…

Which of the following statements about topoisomerases is FALSE? Type I AND type

Which of the following statements about topoisomerases is FALSE? Type I AND type II topoisomerases can both increase or decrease L. In the reaction catalyzed by type I topoisomera…

Which of the following statements about translation elongation in bacteria is TR

Which of the following statements about translation elongation in bacteria is TRUE? A) Charged amino acids are escorted to the A site of the ribosome by an initiation factor. B) T…

Which of the following statements about transport of proteins into mitochondria

Which of the following statements about transport of proteins into mitochondria is incorrect? a) The signal peptidase enzyme will remove the signal sequence as soon as the protein…

Which of the following statements about transport of proteins into mitochondria

Which of the following statements about transport of proteins into mitochondria is incorrect? Which of the following statements about transport of proteins into mitochondria is in…

Which of the following statements about tumor suppressor genes is false? (a) Gen

Which of the following statements about tumor suppressor genes is false? (a) Gene amplification of a tumor suppressor gene is less dangerous than gene amplification of a proto-onc…

Which of the following statements about type I topoisomerases is FALSE? They can

Which of the following statements about type I topoisomerases is FALSE? They can only decrease writhe (W) and therefore, they can only reduce the linking number of DNA. During the…

Which of the following statements about viruses is not true? Question 9 options:

Which of the following statements about viruses is not true? Question 9 options: All viruses are obligatory intracellular parasites. All viruses are obligatory intercellular paras…

Which of the following statements about water is not true? Water will hydrogen b

Which of the following statements about water is not true? Water will hydrogen bond into highly ordered structures or "cages" around non-polar molecules. The electron-rich oxygen …

Which of the following statements about what we have learned by comparing the mo

Which of the following statements about what we have learned by comparing the modern-day human genome to other genomes is true? A. Modern humans whose ancestors come from Europe o…

Which of the following statements about xeroderma pigmentosum (XP) is FALSE? Mut

Which of the following statements about xeroderma pigmentosum (XP) is FALSE? Mutations in one of several genes can contribute to the XP phenotype. Cells from XP patients are defic…

Which of the following statements about zoroastrianism is false? A. The people o

Which of the following statements about zoroastrianism is false? A. The people of Persia were allowed to freely accept it or not accept it; itwas not imposed upon them B. Both Ahu…

Which of the following statements aboutelectrons are false? Check all that apply

Which of the following statements aboutelectrons are false? Check all that apply. 1. Electrons have a charge of 1-. 2. Electrons experience an attraction toprotons. 3. If an atom …

Which of the following statements accurately compares the alveolar ventilate thr

Which of the following statements accurately compares the alveolar ventilate three men? A) Tom's is greater than Dick's, which is greater than Harry's B) Tom's the smallest, Dick'…

Which of the following statements accurately defines ? (A) Toward are on the bac

Which of the following statements accurately defines ? (A) Toward are on the back of the body (B) Toward or the front of the body (C) Away from the head or toward the tall (D) Tow…

Which of the following statements accurately defines superficial? A) Toward the

Which of the following statements accurately defines superficial? A) Toward the body surface: closer to the skin B) Away from the head or toward the tail C) Toward or on the front…

Which of the following statements accurately describe receptor tyrosine kinases

Which of the following statements accurately describe receptor tyrosine kinases (RTKs)? There is more than one correct answer. Select all the true statements( must pick the correc…

Which of the following statements accurately describes homeostasis? a) The body

Which of the following statements accurately describes homeostasis? a) The body has the ability to detect change, activate mechanisms that oppose it, and maintain relatively stabl…

Which of the following statements accurately describes specific bacterial cell w

Which of the following statements accurately describes specific bacterial cell walls? In bacteria with acid-fast cell walls, the carboxylic acid in the walls forms a layer outside…

Which of the following statements accurately describes the nucleosome? The nucle

Which of the following statements accurately describes the nucleosome? The nucleosome is a tetramer of H2A, H2B, H3 and H4. The histone tails are sites of post-translational modif…

Which of the following statements accurately describes the relationship between

Which of the following statements accurately describes the relationship between photosynthesis and cellular respiration? Photosynthesis occurs only in autotrophs; cellular respira…

Which of the following statements accurately describes the relationship between

Which of the following statements accurately describes the relationship between photosynthesis and cellular respiration? Photosynthesis occurs only in autotrophs; cellular respira…

Which of the following statements accurately describes the relationship between

Which of the following statements accurately describes the relationship between photosynthesis and cellular respiration? (1 point) a) Photosynthesis uses light energy to produce A…

Which of the following statements accurately describes the relationship between

Which of the following statements accurately describes the relationship between photosynthesis and cellular respiration? (1 point) a) Photosynthesis uses light energy to produce A…

Which of the following statements applies to a DNA polymerase, RNA polymerase, o

Which of the following statements applies to a DNA polymerase, RNA polymerase, or both? Requires a primer to start Makes DNA Makes RNA Adds new nucleotides to the 3' hydroxyl of t…

Which of the following statements apply to the variation in human skin color? Se

Which of the following statements apply to the variation in human skin color? Select all that apply. 1. Human skin color variation evolved recently in hominid evolution, once some…