Biology and Genetics

11. The DNA sequence encoding the leader peptide of the trp operon was mutated a

11. The DNA sequence encoding the leader peptide of the trp operon was mutated as shown below. The wild-type and altered nucleotide is bolded for ease of identification ATGAAAGCAA…

11. The Middle East Core as defined by C. C Held is made up of 16 countries a. T

11. The Middle East Core as defined by C. C Held is made up of 16 countries a. True b. False 12. The Middle East Core as defined by C. C. Held has a Mashriq and a Maghreb extensio…

11. The Roman town of Pompeii was destroyed by a volcanic eruption in AD79 12. S

11. The Roman town of Pompeii was destroyed by a volcanic eruption in AD79 12. Submarine volcanic eruptions are quiet if they occur below the hydroexplosive zone 13. The hydroexpl…

11. The cerebellum functions to: a. Ald malntenance of the muscle tone, b. malnt

11. The cerebellum functions to: a. Ald malntenance of the muscle tone, b. malntain balance in standing ? coordination of voluntary muscles, d, none of the above 12. The visual ar…

11. The clade __________ includes amoebas with threadlike pseudopodia; includes

11. The clade __________ includes amoebas with threadlike pseudopodia; includes forams A) Alveolates B) Cercozoa & Radiolaria C) Euglenozoa D) Parabasala E)Stramenopila 12. Th…

11. The cold and dry air mass Iis represented by (a) C (b) A (c) D (d) E (e) B 1

11. The cold and dry air mass Iis represented by (a) C (b) A (c) D (d) E (e) B 12. The weather at location er decititdouty wi northwesterly winds, rising air pressure (a) 1 (b) 3 …

11. The diagram below depicts two nucleic acid molecules, and the base pair sequ

11. The diagram below depicts two nucleic acid molecules, and the base pair sequences found at the splicing donor/acceptor sites 205 AATAAATGACTTCTAGAAAGA 253 363 409 4 494 GA 3' …

11. The drosophila alleles for purple eyes (instead of red) and dumpy wings (ins

11. The drosophila alleles for purple eyes (instead of red) and dumpy wings (instead of normal) are both recessive. Gene “E” designates eye color (E: dominant, e: recessive), and …

11. The enthalpies of formation of Al-O, and B,O, are -1676 and 1274 kJ/mol resp

11. The enthalpies of formation of Al-O, and B,O, are -1676 and 1274 kJ/mol respectively. Do these data indicate the rate of oxidation of Al and B? (A) Yes (B) No (C) Cannot say 1…

11. The expression of the BRF1 gene in mice is normally quite low, but mutations

11. The expression of the BRF1 gene in mice is normally quite low, but mutations in a gene called BRF2 lead to increased expression of BRF1. You have a hunch that nucleosomes are …

11. The figure to the right illustrates an Antaretio marine food chain, with arr

11. The figure to the right illustrates an Antaretio marine food chain, with arrows indicating eneruy flow. Which of the following populations of organisms would you expect to hav…

11. The folds inside mitochondria where arisernae icronalm the electron transpor

11. The folds inside mitochondria where arisernae icronalm the electron transport chain occurs 12. Glycolysis produces pyrovate 13. In photosynthesis, water is split to produce la…

11. The folds inside mitochondria where the electron transport chain occurs 12.

11. The folds inside mitochondria where the electron transport chain occurs 12. Glycolysis produces 13. In photosynthesis, water is split to produce reactions oxygen. This occurs …

11. The following patient might show a biological false positive reaction in a V

11. The following patient might show a biological false positive reaction in a VDRL test: a. Secondary syphilis b. Gonorrhea infection c. Tertiary syphilis d. Lupus erythematosus …

11. The mesosphere is weaker than the asthenosphere because it is hotter and und

11. The mesosphere is weaker than the asthenosphere because it is hotter and under less pressure. a. True b. False 12. Continental crust is less dense than oceanic crust. a. True …

11. The most commonly injured ligament in the elbow due to throwing is the _____

11. The most commonly injured ligament in the elbow due to throwing is the _____. a. annular ligament b. radial collateral ligament c. radioulnar ligament d. ulnar collateral liga…

11. The pineal body secretes which hormone that maintains the body\'s internal c

11. The pineal body secretes which hormone that maintains the body's internal clock, the 24-hour wake-sleep cycle, and regulates the onset and duration of sleep? oxytocin calciton…

11. The process of \"targeting\" a protein for degradation via attachment of a s

11. The process of "targeting" a protein for degradation via attachment of a small protein is called: deadenylation methyl-transferation acetylation ubiquitination Save 12. You ha…

11. The protein Gbg is involved in regulating a diverse array of downstream effe

11. The protein Gbg is involved in regulating a diverse array of downstream effector mdtice where the authors designed channels, ion channels, adenylyl cyclase and lecules includi…

11. The purpose of the suicide clause in a life insurance policy is to: 1. Exclu

11. The purpose of the suicide clause in a life insurance policy is to: 1. Exclude payment of death proceeds for suicide only during the first one or two years of the policy, thus…

11. The rate of a reaction can be increased by all of the following except: A) i

11. The rate of a reaction can be increased by all of the following except: A) increasing the temperature. B) increasing the concentration of the reactants. C) increasing the surf…

11. The term amphipathic describes the characteristic of some molecules that hav

11. The term amphipathic describes the characteristic of some molecules that have A) Two polar regions B) Oaly a single polar region C) No polar regions D Roth a polar and nonpola…

11. The trait for \'male-pattern baldness\' is a recessive trait encoded for by

11. The trait for 'male-pattern baldness' is a recessive trait encoded for by "b" Non- balding is encoded for by a dominant allele encoded for by the letter "B". A street survey c…

11. These structures are responsible for the internal morphological framework of

11. These structures are responsible for the internal morphological framework of the cell. 12. The spliced product of heterogeneous nuclear RNA will be made and exported out of th…

11. This kind of cloud produces most of the precipitation at a warm front a. cum

11. This kind of cloud produces most of the precipitation at a warm front a. cumulonimbus b. nimbostratus c cirrus d. altostratus 12. Together, oxygen and nitrogen comprise what p…

11. To have communication between cells, you must have a A) B) C) D) receptor. s

11. To have communication between cells, you must have a A) B) C) D) receptor. signaling molecule. responding cell. All of these choices are correct. 12. A cell that responds to a…

11. True or False.All Enzymes are proteins. 12. The enzyme that converts your su

11. True or False.All Enzymes are proteins. 12. The enzyme that converts your substrate to a product is known as 13. Enzymes acts as catalysts because of which protein structure t…

11. What are Okazaki fragments? (2 pt) a. short DNA pieces that explain how DNA

11. What are Okazaki fragments? (2 pt) a. short DNA pieces that explain how DNA is synthesized on the lagging strand b. short DNA pieces that explain how DNA is synthesized on the…

11. What are Okazaki fragments? (2 pt) a. short DNA pieces that explain how DNA

11. What are Okazaki fragments? (2 pt) a. short DNA pieces that explain how DNA is synthesized on the lagging strand. b. short DNA pieces that explain how DNA is synthesized on th…

11. What are the 3 steps in the PCR thermocycle? What happens in each step? Plea

11. What are the 3 steps in the PCR thermocycle? What happens in each step? Please indicate the approximate temperature (in Celsius) for each step. 12. What are the two main funct…

11. What are the post-translational modifications that take place in eukaryotes?

11. What are the post-translational modifications that take place in eukaryotes? Give examples. 12. Compare and contrast gene expression (transcription and translation) in prokary…

11. What are the principle elements in the body? List the 4 major elements in or

11. What are the principle elements in the body? List the 4 major elements in order of their abundance. 12. Explain the polarity of molecules. 13. What is the major difference bet…

11. What does voltage-gated ion channel and ligand-gated ion channel do in neuro

11. What does voltage-gated ion channel and ligand-gated ion channel do in neurons? 12. Why do cells maintain low level of Ca++? 13. How to move CI-across the membrane? When this …

11. What is Kohler Illumination? 12. What type of microscope produces a 3-dimens

11. What is Kohler Illumination? 12. What type of microscope produces a 3-dimensional image? Fill in the blank space 13. When light is passed through the specimen in a microscope,…

11. What is \"heat index?\" 12. Define relative humidity 13. How is relative hum

11. What is "heat index?" 12. Define relative humidity 13. How is relative humidity different from specific relative humidity? 14. What does 100% relative humidity means? 15. Expl…

11. What is the anatomical structure (shape) of DNA? 12. Is DNA single or double

11. What is the anatomical structure (shape) of DNA? 12. Is DNA single or double stranded? 13. What bond holds the two strands in DNA together? 14. In a eukaryotic cell, where doe…

11. What is the first amino ackd of any initial protein that is A. Valine C. Lys

11. What is the first amino ackd of any initial protein that is A. Valine C. Lysine D. Tryptophan E. Methionine 12. Choose all that apply. Polymerase Chain Reaction (PCR) can be u…

11. What is the main function(s) of squamous stratified epithelial tissue? 12. W

11. What is the main function(s) of squamous stratified epithelial tissue? 12. What is the main function(s) of the simple cuboidal epithelial tissue? 13. What is the main function…

11. What is the nature of the boundary between the Redwall Limestone and the Sup

11. What is the nature of the boundary between the Redwall Limestone and the Supai Group? PARD One of the best-kept secrets of the US Park Ser vice is Grand Canyon National Mionum…

11. What type of staining is most useful for studying the morphology of bacteria

11. What type of staining is most useful for studying the morphology of bacterial cells and characterizing some of the external structures such as the capsule? a. staining b. stai…

11. What type of staining is most useful for studying the morphology of bacteria

11. What type of staining is most useful for studying the morphology of bacterial cells and characterizing. some of the external structures such as the capsule? a. staining b. sta…

11. What type of staining is most useful for studying the morphology of bacteria

11. What type of staining is most useful for studying the morphology of bacterial cells and characterizing some of the external structures such as the capsule? a. staining b. stai…

11. When \"the top\" is concerned with continually justifying its authority so p

11. When "the top" is concerned with continually justifying its authority so people will continue to put up with t, Habermas would diagnose a case of: (p. 355) a) administrative d…

11. Where are the protein complexes that makeup the electron transport chain loc

11. Where are the protein complexes that makeup the electron transport chain located in the mitochondrion of a eukaryotic cell? * 12. The final electron acceptor in the electron t…

11. Where is the largest continental rift in the world? A. Southern California B

11. Where is the largest continental rift in the world? A. Southern California B. Germany C. East Africa D. South America 12. Which type of arc is the most apparent sign of a subd…

11. Which atom has the largest radius? A) Ga C) Rb B) K D) Br 12. Which bond is

11. Which atom has the largest radius? A) Ga C) Rb B) K D) Br 12. Which bond is the most polar? A) C-C C) c-C B) C-F D) C-N 13. Write a balanced chemical equation for the reaction…

11. Which condition causes autoimmune damage to receptors for acetylcholine at t

11.  Which condition causes autoimmune damage to receptors for acetylcholine at the neuromuscular junction? 12.  Which is true in regards to Immune memory? 13.  Which type of immu…

11. Which enzyme is not functioning in a cell if all tRNA are uncharged? Ef-Tu b

11. Which enzyme is not functioning in a cell if all tRNA are uncharged? Ef-Tu b. Ef-G c. Peptidyl transferase. d. Amino Acetyl transferase. 12. If G capping fails, mRNA would: No…

11. Which of following is a difference between a fat and oil? a. b. c. a fat has

11. Which of following is a difference between a fat and oil? a. b. c. a fat has a lower melting temperature than oil a fat contains unsaturated fatty acids and oil contains satur…

11. Which of the following are eukaryotes? 1. algae 2. Viruses 3. bacteria 4. Pr

11. Which of the following are eukaryotes? 1. algae 2. Viruses 3. bacteria 4. Protozoa a. 1,2 b. 2,4 c. 1,3 d1,4 12. A capsule enables these bacteria to adhere to specific surface…